ID: 922984304

View in Genome Browser
Species Human (GRCh38)
Location 1:229854039-229854061
Sequence AGAAGTCAGCGTGAGGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984304_922984314 24 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984304_922984309 2 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984304_922984312 17 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984304_922984313 23 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984313 1:229854085-229854107 GGAGTATTACCCCAAGGAGCTGG No data
922984304_922984308 1 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984308 1:229854063-229854085 ACACTCCCACTGCAGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984304 Original CRISPR AGAAGTCAGCGTGAGGGGCG CGG (reversed) Intergenic
No off target data available for this crispr