ID: 922984306

View in Genome Browser
Species Human (GRCh38)
Location 1:229854045-229854067
Sequence AGTGTGAGAAGTCAGCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984306_922984313 17 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984313 1:229854085-229854107 GGAGTATTACCCCAAGGAGCTGG No data
922984306_922984308 -5 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984308 1:229854063-229854085 ACACTCCCACTGCAGTTGTCAGG No data
922984306_922984314 18 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984306_922984312 11 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984306_922984309 -4 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984306 Original CRISPR AGTGTGAGAAGTCAGCGTGA GGG (reversed) Intergenic
No off target data available for this crispr