ID: 922984309

View in Genome Browser
Species Human (GRCh38)
Location 1:229854064-229854086
Sequence CACTCCCACTGCAGTTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984303_922984309 9 Left 922984303 1:229854032-229854054 CCTGGGGCCGCGCCCCTCACGCT No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984307_922984309 -5 Left 922984307 1:229854046-229854068 CCTCACGCTGACTTCTCACACTC No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984301_922984309 25 Left 922984301 1:229854016-229854038 CCTATTAAGAGGAAGACCTGGGG No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984305_922984309 -3 Left 922984305 1:229854044-229854066 CCCCTCACGCTGACTTCTCACAC No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984306_922984309 -4 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data
922984304_922984309 2 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984309 1:229854064-229854086 CACTCCCACTGCAGTTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984309 Original CRISPR CACTCCCACTGCAGTTGTCA GGG Intergenic
No off target data available for this crispr