ID: 922984311

View in Genome Browser
Species Human (GRCh38)
Location 1:229854069-229854091
Sequence ATACTCCCTGACAACTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984311_922984320 26 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984320 1:229854118-229854140 TGATCCAGGGCCCAGTTCCTAGG No data
922984311_922984322 28 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984322 1:229854120-229854142 ATCCAGGGCCCAGTTCCTAGGGG No data
922984311_922984321 27 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984321 1:229854119-229854141 GATCCAGGGCCCAGTTCCTAGGG No data
922984311_922984313 -7 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984313 1:229854085-229854107 GGAGTATTACCCCAAGGAGCTGG No data
922984311_922984318 12 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984318 1:229854104-229854126 CTGGGAAACAACTGTGATCCAGG No data
922984311_922984314 -6 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984311_922984319 13 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984319 1:229854105-229854127 TGGGAAACAACTGTGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984311 Original CRISPR ATACTCCCTGACAACTGCAG TGG (reversed) Intergenic
No off target data available for this crispr