ID: 922984312

View in Genome Browser
Species Human (GRCh38)
Location 1:229854079-229854101
Sequence TGTCAGGGAGTATTACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984304_922984312 17 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984305_922984312 12 Left 922984305 1:229854044-229854066 CCCCTCACGCTGACTTCTCACAC No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984307_922984312 10 Left 922984307 1:229854046-229854068 CCTCACGCTGACTTCTCACACTC No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984306_922984312 11 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data
922984303_922984312 24 Left 922984303 1:229854032-229854054 CCTGGGGCCGCGCCCCTCACGCT No data
Right 922984312 1:229854079-229854101 TGTCAGGGAGTATTACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984312 Original CRISPR TGTCAGGGAGTATTACCCCA AGG Intergenic
No off target data available for this crispr