ID: 922984314

View in Genome Browser
Species Human (GRCh38)
Location 1:229854086-229854108
Sequence GAGTATTACCCCAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922984304_922984314 24 Left 922984304 1:229854039-229854061 CCGCGCCCCTCACGCTGACTTCT No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984310_922984314 -5 Left 922984310 1:229854068-229854090 CCCACTGCAGTTGTCAGGGAGTA No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984307_922984314 17 Left 922984307 1:229854046-229854068 CCTCACGCTGACTTCTCACACTC No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984306_922984314 18 Left 922984306 1:229854045-229854067 CCCTCACGCTGACTTCTCACACT No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984305_922984314 19 Left 922984305 1:229854044-229854066 CCCCTCACGCTGACTTCTCACAC No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data
922984311_922984314 -6 Left 922984311 1:229854069-229854091 CCACTGCAGTTGTCAGGGAGTAT No data
Right 922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922984314 Original CRISPR GAGTATTACCCCAAGGAGCT GGG Intergenic
No off target data available for this crispr