ID: 922985606

View in Genome Browser
Species Human (GRCh38)
Location 1:229863957-229863979
Sequence CTGCTCACTGAAAGTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922985604_922985606 -8 Left 922985604 1:229863942-229863964 CCAGCTGAGATCCAGCTGCTCAC No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985601_922985606 6 Left 922985601 1:229863928-229863950 CCAAGGTTTCCTTCCCAGCTGAG No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985600_922985606 19 Left 922985600 1:229863915-229863937 CCTAGGAGCACTTCCAAGGTTTC No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985597_922985606 26 Left 922985597 1:229863908-229863930 CCCTGGTCCTAGGAGCACTTCCA No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985602_922985606 -3 Left 922985602 1:229863937-229863959 CCTTCCCAGCTGAGATCCAGCTG No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985603_922985606 -7 Left 922985603 1:229863941-229863963 CCCAGCTGAGATCCAGCTGCTCA No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985598_922985606 25 Left 922985598 1:229863909-229863931 CCTGGTCCTAGGAGCACTTCCAA No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data
922985596_922985606 30 Left 922985596 1:229863904-229863926 CCAGCCCTGGTCCTAGGAGCACT No data
Right 922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922985606 Original CRISPR CTGCTCACTGAAAGTCAAGC AGG Intergenic
No off target data available for this crispr