ID: 922988588

View in Genome Browser
Species Human (GRCh38)
Location 1:229886061-229886083
Sequence CAAGCACATGTTGCTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922988588_922988591 -8 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988591 1:229886076-229886098 TGTGCTTGTGTCCTTTCCCAGGG No data
922988588_922988596 6 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988596 1:229886090-229886112 TTCCCAGGGATTGCTTCTGGGGG No data
922988588_922988594 4 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988594 1:229886088-229886110 CTTTCCCAGGGATTGCTTCTGGG No data
922988588_922988590 -9 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988590 1:229886075-229886097 ATGTGCTTGTGTCCTTTCCCAGG No data
922988588_922988595 5 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988595 1:229886089-229886111 TTTCCCAGGGATTGCTTCTGGGG No data
922988588_922988593 3 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988593 1:229886087-229886109 CCTTTCCCAGGGATTGCTTCTGG No data
922988588_922988599 21 Left 922988588 1:229886061-229886083 CCCAAGGAAGCAACATGTGCTTG No data
Right 922988599 1:229886105-229886127 TCTGGGGGTAACTCAAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922988588 Original CRISPR CAAGCACATGTTGCTTCCTT GGG (reversed) Intergenic
No off target data available for this crispr