ID: 922992581

View in Genome Browser
Species Human (GRCh38)
Location 1:229927360-229927382
Sequence ATCAACACACTGACATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922992581_922992583 -5 Left 922992581 1:229927360-229927382 CCCTGAGATGTCAGTGTGTTGAT No data
Right 922992583 1:229927378-229927400 TTGATGCCAACCCCCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922992581 Original CRISPR ATCAACACACTGACATCTCA GGG (reversed) Intergenic
No off target data available for this crispr