ID: 922992777

View in Genome Browser
Species Human (GRCh38)
Location 1:229929565-229929587
Sequence TCCAGAGCTCTCCCTCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922992777_922992783 29 Left 922992777 1:229929565-229929587 CCACACGGAGGGAGAGCTCTGGA No data
Right 922992783 1:229929617-229929639 AGCAGAGCACTGATCATGCAAGG No data
922992777_922992784 30 Left 922992777 1:229929565-229929587 CCACACGGAGGGAGAGCTCTGGA No data
Right 922992784 1:229929618-229929640 GCAGAGCACTGATCATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922992777 Original CRISPR TCCAGAGCTCTCCCTCCGTG TGG (reversed) Intergenic
No off target data available for this crispr