ID: 922994170

View in Genome Browser
Species Human (GRCh38)
Location 1:229942991-229943013
Sequence GCCCACCTGACAACAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922994165_922994170 17 Left 922994165 1:229942951-229942973 CCTCTGCTGTGTTTTCTAACTCA No data
Right 922994170 1:229942991-229943013 GCCCACCTGACAACAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922994170 Original CRISPR GCCCACCTGACAACAGTGGC TGG Intergenic
No off target data available for this crispr