ID: 922998485

View in Genome Browser
Species Human (GRCh38)
Location 1:229985606-229985628
Sequence CGCACAGGAGGTAGGATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922998485_922998489 23 Left 922998485 1:229985606-229985628 CCTATCATCCTACCTCCTGTGCG No data
Right 922998489 1:229985652-229985674 TTCTGCCTCTCATTCACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922998485 Original CRISPR CGCACAGGAGGTAGGATGAT AGG (reversed) Intergenic
No off target data available for this crispr