ID: 922998489

View in Genome Browser
Species Human (GRCh38)
Location 1:229985652-229985674
Sequence TTCTGCCTCTCATTCACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922998485_922998489 23 Left 922998485 1:229985606-229985628 CCTATCATCCTACCTCCTGTGCG No data
Right 922998489 1:229985652-229985674 TTCTGCCTCTCATTCACTCTTGG No data
922998488_922998489 8 Left 922998488 1:229985621-229985643 CCTGTGCGACATCACTGTGATTT No data
Right 922998489 1:229985652-229985674 TTCTGCCTCTCATTCACTCTTGG No data
922998487_922998489 11 Left 922998487 1:229985618-229985640 CCTCCTGTGCGACATCACTGTGA No data
Right 922998489 1:229985652-229985674 TTCTGCCTCTCATTCACTCTTGG No data
922998486_922998489 15 Left 922998486 1:229985614-229985636 CCTACCTCCTGTGCGACATCACT No data
Right 922998489 1:229985652-229985674 TTCTGCCTCTCATTCACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922998489 Original CRISPR TTCTGCCTCTCATTCACTCT TGG Intergenic
No off target data available for this crispr