ID: 922999144

View in Genome Browser
Species Human (GRCh38)
Location 1:229991758-229991780
Sequence ACAGTGAGAGGTAAAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922999144_922999148 21 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999148 1:229991802-229991824 AGTAGCTCAGCCAGGTACTTTGG No data
922999144_922999147 13 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG No data
922999144_922999151 29 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999151 1:229991810-229991832 AGCCAGGTACTTTGGGTGTAGGG No data
922999144_922999150 28 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999150 1:229991809-229991831 CAGCCAGGTACTTTGGGTGTAGG No data
922999144_922999149 22 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999149 1:229991803-229991825 GTAGCTCAGCCAGGTACTTTGGG No data
922999144_922999146 -2 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999146 1:229991779-229991801 GTTTCTGAAAGCTGCGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922999144 Original CRISPR ACAGTGAGAGGTAAAAAAAA TGG (reversed) Intergenic