ID: 922999145

View in Genome Browser
Species Human (GRCh38)
Location 1:229991770-229991792
Sequence CAGCTTTCAGAAACAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922999145_922999151 17 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999151 1:229991810-229991832 AGCCAGGTACTTTGGGTGTAGGG No data
922999145_922999147 1 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG No data
922999145_922999148 9 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999148 1:229991802-229991824 AGTAGCTCAGCCAGGTACTTTGG No data
922999145_922999150 16 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999150 1:229991809-229991831 CAGCCAGGTACTTTGGGTGTAGG No data
922999145_922999149 10 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999149 1:229991803-229991825 GTAGCTCAGCCAGGTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922999145 Original CRISPR CAGCTTTCAGAAACAGTGAG AGG (reversed) Intergenic