ID: 922999146

View in Genome Browser
Species Human (GRCh38)
Location 1:229991779-229991801
Sequence GTTTCTGAAAGCTGCGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922999143_922999146 28 Left 922999143 1:229991728-229991750 CCAAAACTTAGTGGCTTAAAACA No data
Right 922999146 1:229991779-229991801 GTTTCTGAAAGCTGCGATTCAGG No data
922999144_922999146 -2 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999146 1:229991779-229991801 GTTTCTGAAAGCTGCGATTCAGG No data
922999141_922999146 30 Left 922999141 1:229991726-229991748 CCCCAAAACTTAGTGGCTTAAAA No data
Right 922999146 1:229991779-229991801 GTTTCTGAAAGCTGCGATTCAGG No data
922999142_922999146 29 Left 922999142 1:229991727-229991749 CCCAAAACTTAGTGGCTTAAAAC No data
Right 922999146 1:229991779-229991801 GTTTCTGAAAGCTGCGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922999146 Original CRISPR GTTTCTGAAAGCTGCGATTC AGG Intergenic