ID: 922999147

View in Genome Browser
Species Human (GRCh38)
Location 1:229991794-229991816
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922999144_922999147 13 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG No data
922999145_922999147 1 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type