ID: 922999150

View in Genome Browser
Species Human (GRCh38)
Location 1:229991809-229991831
Sequence CAGCCAGGTACTTTGGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922999144_922999150 28 Left 922999144 1:229991758-229991780 CCATTTTTTTTACCTCTCACTGT No data
Right 922999150 1:229991809-229991831 CAGCCAGGTACTTTGGGTGTAGG No data
922999145_922999150 16 Left 922999145 1:229991770-229991792 CCTCTCACTGTTTCTGAAAGCTG No data
Right 922999150 1:229991809-229991831 CAGCCAGGTACTTTGGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922999150 Original CRISPR CAGCCAGGTACTTTGGGTGT AGG Intergenic