ID: 923000766

View in Genome Browser
Species Human (GRCh38)
Location 1:230004826-230004848
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923000763_923000766 -10 Left 923000763 1:230004813-230004835 CCCAACAGAATTTGCCAGTGGCC No data
Right 923000766 1:230004826-230004848 GCCAGTGGCCTGCAATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr