ID: 923001490

View in Genome Browser
Species Human (GRCh38)
Location 1:230009727-230009749
Sequence TCTGAGTGAAGTAGTTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923001483_923001490 27 Left 923001483 1:230009677-230009699 CCTGTGGTTCTGAAGAGGTGGCT No data
Right 923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG No data
923001489_923001490 -8 Left 923001489 1:230009712-230009734 CCTGCAAGGTAGGTATCTGAGTG No data
Right 923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG No data
923001488_923001490 -7 Left 923001488 1:230009711-230009733 CCCTGCAAGGTAGGTATCTGAGT No data
Right 923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923001490 Original CRISPR TCTGAGTGAAGTAGTTTATG TGG Intergenic
No off target data available for this crispr