ID: 923004230

View in Genome Browser
Species Human (GRCh38)
Location 1:230032807-230032829
Sequence TAACTGCAACAGAAGCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923004230_923004231 5 Left 923004230 1:230032807-230032829 CCACGATGCTTCTGTTGCAGTTA No data
Right 923004231 1:230032835-230032857 AACATTAGTGAAACCCACTAAGG No data
923004230_923004233 18 Left 923004230 1:230032807-230032829 CCACGATGCTTCTGTTGCAGTTA No data
Right 923004233 1:230032848-230032870 CCCACTAAGGAAAAGAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923004230 Original CRISPR TAACTGCAACAGAAGCATCG TGG (reversed) Intergenic
No off target data available for this crispr