ID: 923008087

View in Genome Browser
Species Human (GRCh38)
Location 1:230067633-230067655
Sequence GAGGGGCGACGTCCACGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923008087_923008093 16 Left 923008087 1:230067633-230067655 CCCTCTCGTGGACGTCGCCCCTC 0: 1
1: 0
2: 2
3: 2
4: 40
Right 923008093 1:230067672-230067694 TTCGAGTCTTGTCCGGCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 13
923008087_923008092 9 Left 923008087 1:230067633-230067655 CCCTCTCGTGGACGTCGCCCCTC 0: 1
1: 0
2: 2
3: 2
4: 40
Right 923008092 1:230067665-230067687 GTCGTAATTCGAGTCTTGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 16
923008087_923008094 17 Left 923008087 1:230067633-230067655 CCCTCTCGTGGACGTCGCCCCTC 0: 1
1: 0
2: 2
3: 2
4: 40
Right 923008094 1:230067673-230067695 TCGAGTCTTGTCCGGCCGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923008087 Original CRISPR GAGGGGCGACGTCCACGAGA GGG (reversed) Intronic