ID: 923008993

View in Genome Browser
Species Human (GRCh38)
Location 1:230073456-230073478
Sequence GCAGGAGGCAAGAGCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 15, 3: 82, 4: 658}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923008993_923008999 -3 Left 923008993 1:230073456-230073478 CCTGCCTGGCTCTTGCCTCCTGC 0: 1
1: 0
2: 15
3: 82
4: 658
Right 923008999 1:230073476-230073498 TGCAGCACAGGGTGAAACACTGG 0: 1
1: 0
2: 1
3: 17
4: 225
923008993_923009000 30 Left 923008993 1:230073456-230073478 CCTGCCTGGCTCTTGCCTCCTGC 0: 1
1: 0
2: 15
3: 82
4: 658
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923008993 Original CRISPR GCAGGAGGCAAGAGCCAGGC AGG (reversed) Intronic
900093993 1:932996-933018 GGGGGAGGCCAGAGCCTGGCAGG - Intronic
900118733 1:1039779-1039801 GGAGGAGGCAAGAGTGAGGTGGG + Intronic
900356303 1:2266451-2266473 ACAGGAAGCAGGACCCAGGCAGG - Intronic
900436634 1:2634146-2634168 GCAGGAGCCTCCAGCCAGGCTGG - Intergenic
900478854 1:2888661-2888683 TCAGGATGCAAGGACCAGGCAGG - Intergenic
900502374 1:3012708-3012730 CCAGGAGCCCAGACCCAGGCGGG - Intergenic
900626697 1:3611695-3611717 GCTGGAAGCAGGAGCCGGGCTGG - Intergenic
900927130 1:5712765-5712787 GCAGGAAGTAAGAAGCAGGCTGG - Intergenic
900932510 1:5746096-5746118 GGGGGGGGCCAGAGCCAGGCAGG + Intergenic
901082712 1:6592678-6592700 TGAGGACGCAAGAGCCAGTCAGG + Exonic
901167301 1:7229659-7229681 GGAGGAGGCAAGAGCCAGTCTGG + Intronic
901430613 1:9211780-9211802 GGAGGGGGCAACAGGCAGGCTGG + Intergenic
901680177 1:10908515-10908537 GGAGGAGGCAAGCCCGAGGCAGG - Intergenic
902038176 1:13472894-13472916 TTAGAAGGCATGAGCCAGGCTGG - Intergenic
902385556 1:16073587-16073609 GCAGCAGGGACGACCCAGGCTGG - Exonic
902581097 1:17408129-17408151 GCGCGAGGCAGGATCCAGGCGGG + Exonic
902760697 1:18578989-18579011 GCAGGAGGCATGAACCTGGGAGG + Intergenic
903016574 1:20365852-20365874 GCAGGAGGCAGAAGCCAGCGTGG + Intergenic
903064319 1:20690266-20690288 GCAGGAGTCTCGGGCCAGGCTGG - Exonic
903447786 1:23433367-23433389 GCAGAAGGAAAGAGCCAGATTGG - Intronic
904597397 1:31655465-31655487 GCAGGACAGAAGGGCCAGGCAGG - Exonic
904809275 1:33152871-33152893 GGAGAAGGCAGGAGCAAGGCAGG + Intronic
905105843 1:35563208-35563230 TCAGGTGGCACCAGCCAGGCAGG - Exonic
905328273 1:37173976-37173998 GAGGGAGGCCAGAGACAGGCTGG + Intergenic
905388634 1:37622113-37622135 GGAGGAGCCAACAGACAGGCAGG + Intronic
905473034 1:38207351-38207373 GCCTGAGGCAGGAGGCAGGCAGG + Intergenic
905812513 1:40923104-40923126 GCAGGAGGAAAGAGCTATTCCGG + Intergenic
905974481 1:42164865-42164887 CTAGGAGATAAGAGCCAGGCAGG + Intergenic
906207809 1:43996433-43996455 CCAGGGGACAAGAGTCAGGCTGG - Exonic
906371163 1:45255079-45255101 GCAGCAGGCAAGAGCCCATCAGG - Intronic
907270377 1:53287732-53287754 GCAGGAGGAATGAGGCAGGAGGG + Intronic
907290949 1:53412538-53412560 GCAGCGGGCAGGAGCCAGGGCGG - Intergenic
907329396 1:53661349-53661371 GGAGGAGTTAAGAGGCAGGCTGG + Intronic
907365742 1:53958202-53958224 GCAACAGGAAAGATCCAGGCAGG - Exonic
909915172 1:81308988-81309010 GCAGCAGCAAAGAGCCAGGTGGG - Intronic
910115403 1:83726269-83726291 GCAGAAAGCAAGAAGCAGGCCGG + Intergenic
910292827 1:85616035-85616057 GCAGGAGGCCCGCGCCAGGCTGG - Intergenic
910619961 1:89242607-89242629 TAAAGAGGCAAGATCCAGGCTGG - Intergenic
911625970 1:100124955-100124977 GCAGGAGGTGAGTGGCAGGCAGG - Intronic
911659982 1:100490504-100490526 GAAGGAGGAAAGATCCAGACAGG - Intronic
913219237 1:116646033-116646055 GCCTGAGGCCACAGCCAGGCTGG - Intronic
913225342 1:116693946-116693968 GCTTGGGGCAGGAGCCAGGCTGG - Intergenic
914247846 1:145899085-145899107 GAAGGAGGCAAGAGTGAGGGTGG + Intronic
914912767 1:151800784-151800806 GCAGGAGGCACAACGCAGGCGGG + Exonic
914920955 1:151847213-151847235 GCAGGAGGCAGGAGGCAGGCAGG + Intergenic
914920964 1:151847240-151847262 GCAGGAGGCAGGAGGCAGGCAGG + Intergenic
914920980 1:151847287-151847309 GCAGGAGGCAGGAGGCAGGCAGG + Exonic
914920989 1:151847314-151847336 GCAGGAGGCAGGAGGCAGGCAGG + Exonic
914977050 1:152375580-152375602 GCAGGGGACTAGAGCCAGGGAGG - Intergenic
915622021 1:157091879-157091901 GCAGGAGGGAAGAGACTGGCTGG + Intergenic
915915183 1:159936653-159936675 AGAGGAGGCAAAGGCCAGGCTGG - Intronic
917348943 1:174056875-174056897 GCAGGCGCCAAGAGCGAGGGAGG + Intergenic
917504206 1:175613494-175613516 GCAGGCGAGAAGAACCAGGCAGG - Intronic
917978697 1:180256211-180256233 GGCGGAGGGAAGAGCCAGACGGG - Intronic
918071663 1:181137679-181137701 GAAGGAGCCCAGAGCCAGGAAGG - Intergenic
918423479 1:184386711-184386733 GCCGGAGGGAAGACCCCGGCGGG - Intergenic
918435933 1:184512845-184512867 GCAGGAGGTGAGCGGCAGGCGGG + Intronic
919070688 1:192751476-192751498 GCACGTGGCAAGAGACTGGCGGG + Intergenic
919762421 1:201106392-201106414 GCTGGAGGCAAGAGACAGAGAGG - Intronic
920377809 1:205518779-205518801 GGAGGAAGGAGGAGCCAGGCTGG - Intronic
920615405 1:207487483-207487505 GAAGGAGGCAGGAGCCTGACTGG + Intronic
921049801 1:211502928-211502950 GCAGGTGGACAGAGCCAGGGAGG + Intergenic
922018374 1:221676191-221676213 GTAGGAAGGGAGAGCCAGGCAGG + Intergenic
922100455 1:222473922-222473944 CCAGGAGGCATGAGCTGGGCTGG + Intergenic
922500612 1:226094559-226094581 GCACAAGGCAAGCTCCAGGCAGG + Intergenic
922514867 1:226199799-226199821 GCATGAGGCAAAAACCAGCCAGG - Intergenic
923008993 1:230073456-230073478 GCAGGAGGCAAGAGCCAGGCAGG - Intronic
923064527 1:230505698-230505720 GATGGAGGCATGACCCAGGCGGG - Intergenic
923800700 1:237205740-237205762 GCAGGGGGCAAGGGCACGGCTGG + Intronic
923805212 1:237250184-237250206 GTGGAAGGCAAGAGCCACGCTGG - Intronic
1063498028 10:6528094-6528116 GCAGGAGGGAAGAGGGAGGAGGG - Intronic
1064139035 10:12774681-12774703 GCAGGAAGTGAGAGGCAGGCTGG + Intronic
1064582317 10:16807032-16807054 ACAGCAGGCATGAGTCAGGCTGG + Intronic
1065483750 10:26217431-26217453 GCAGAAGGCAAGCGGGAGGCTGG - Intronic
1065975110 10:30835294-30835316 GCAGGCGTGAAGAGCCAGCCTGG - Intronic
1066098651 10:32097604-32097626 GCAGAAGGCAAAAGAGAGGCAGG + Intergenic
1066950458 10:42111891-42111913 GCAGGAGCCAAAAGCCATGGTGG + Intergenic
1067455677 10:46418036-46418058 GCAAGAGGCAGGAGCCAAGTGGG - Intergenic
1067631526 10:47966603-47966625 GCAAGAGGCAGGAGCCAAGTGGG + Intergenic
1069043881 10:63722565-63722587 GCTGAAGGCAAGAGACTGGCTGG - Intergenic
1069589465 10:69632843-69632865 GCAGCAGGCAGGTGCCAGGCTGG + Exonic
1069635707 10:69923606-69923628 AGAGGAAGCAAGACCCAGGCTGG + Intronic
1069715082 10:70515436-70515458 CCAGCAGGGCAGAGCCAGGCTGG - Intronic
1069749752 10:70737556-70737578 GCAGGAGGCAGGGGGCAGGCTGG - Intronic
1069840591 10:71337102-71337124 GCAGGAGGCTAGATGCAGCCAGG - Intronic
1069842446 10:71348249-71348271 GAAGGAGGCAAAGGCCAGGCTGG - Intronic
1070369819 10:75771588-75771610 TCAGGAAGCAGGAGCCAGGTTGG + Intronic
1070696713 10:78569366-78569388 GCAAGAGCCAAGAGCCATGGAGG - Intergenic
1071462872 10:85915019-85915041 GGAGGAGGCCAGGGCCAGACAGG + Intronic
1071579525 10:86756690-86756712 GGAGGAGGCAGGAGCGAGGAGGG + Exonic
1072555204 10:96509540-96509562 GCAGGAGGAATGAGACAGGGAGG - Intronic
1072899539 10:99394863-99394885 GAGGGAGGGAACAGCCAGGCAGG + Intergenic
1073086708 10:100895701-100895723 AAAGGAGTCAAGAGGCAGGCGGG - Intergenic
1073180294 10:101579290-101579312 GCCTGAAGCAAGAGCCAGCCCGG - Exonic
1073205107 10:101764913-101764935 GCAGCAGGCAAGAGGGAGGGCGG + Intergenic
1073206241 10:101770887-101770909 GCAGGAGGCCAGAGCAGGCCAGG - Intronic
1074080890 10:110167187-110167209 AGAGGAGGGAAGACCCAGGCCGG - Intergenic
1074459571 10:113624958-113624980 GCAGGTGGCAAGGGCGAGGTGGG + Intronic
1074515870 10:114168830-114168852 GCAGCAGGCAAGAACCTGTCAGG + Intronic
1074731729 10:116385344-116385366 GAGGTAGGCAAGAGCCAGGATGG - Intergenic
1075438907 10:122463928-122463950 GCAGCAGGAGTGAGCCAGGCTGG + Intronic
1075584625 10:123648676-123648698 GCCAAAGGCAAGACCCAGGCTGG + Intergenic
1076161488 10:128247400-128247422 GGAAGAGGCCAGACCCAGGCTGG + Intergenic
1076554104 10:131311207-131311229 GCCGGAGGCCAGAGCCGGGCCGG + Intronic
1076555338 10:131317798-131317820 GCTGTAGGGAAGACCCAGGCCGG + Intergenic
1076627507 10:131831090-131831112 ACAGGAGGCAGGAGCCAAGCTGG + Intergenic
1077159346 11:1105639-1105661 GGAGGAGGCAGGAGGGAGGCAGG - Intergenic
1077185005 11:1231932-1231954 GCAGGGGCCAGGAGCCAGGTGGG + Intronic
1077272306 11:1686990-1687012 GAAGGAGGGAAGAGGGAGGCAGG - Intergenic
1077332147 11:1988467-1988489 GCGGCAGGGCAGAGCCAGGCTGG + Intergenic
1077360185 11:2137416-2137438 GCAGGAGAGAAGAGACTGGCTGG - Intronic
1077920669 11:6639819-6639841 GCAGGAAGCAAGTTCCAGGCTGG + Exonic
1077992363 11:7423372-7423394 GGAGGAGGCAACAGGCAGACTGG + Intronic
1077993669 11:7434377-7434399 GAAGGAACCAAAAGCCAGGCAGG + Intronic
1078606958 11:12785369-12785391 ACAGGAGGAAAGAGCCATGCAGG - Intronic
1079125786 11:17718043-17718065 CCAGGAGGGGAGATCCAGGCAGG + Intergenic
1079128265 11:17733843-17733865 GCAGCAGGCATGGGCCAGGAAGG + Intergenic
1079479007 11:20861444-20861466 GCAGGAGGCTAGAGGCTTGCAGG - Intronic
1080638383 11:34143145-34143167 TCATGTGGGAAGAGCCAGGCAGG + Intronic
1080655910 11:34258028-34258050 CAAGGAGGCAAGGCCCAGGCAGG + Intronic
1081181820 11:39993083-39993105 GCAGGAGGCAAGGGAGAAGCAGG - Intergenic
1081617976 11:44601640-44601662 GGAGGAGGCCAGAGCCATGCAGG - Intronic
1081683584 11:45025953-45025975 GCAGGAGGCGGGGGGCAGGCTGG + Intergenic
1082081002 11:48012566-48012588 CCAGGAGGCAAGAGCAACCCTGG + Intronic
1082813550 11:57493609-57493631 GCAGGGGGCAAAAGACAGCCAGG + Intronic
1083393727 11:62374101-62374123 GCACGAGGCAGGATCCAGGCAGG - Intronic
1083592858 11:63905403-63905425 TCATGAGGCATGAGCCAGGCTGG + Intronic
1083614856 11:64021321-64021343 GCAGGAGGCCAGAGCCACGAAGG + Intronic
1083938834 11:65884320-65884342 GCAGGAGGCGAGGTCCTGGCAGG + Intronic
1084057584 11:66646316-66646338 GCAGGAGGCAGGAGGCAGGGAGG - Exonic
1084196237 11:67524675-67524697 GGAGGAGGCCAAAGGCAGGCAGG - Intergenic
1084322501 11:68381482-68381504 GCTTGGGGCAAGGGCCAGGCAGG - Intronic
1084947675 11:72647416-72647438 GGAGGAGGCAGTATCCAGGCAGG + Intronic
1084947801 11:72648257-72648279 GGAGGAGGCAGTATCCAGGCAGG - Intronic
1084957407 11:72698638-72698660 GCTGGAGGGAAGAGGCAGGGAGG - Intronic
1085044835 11:73346757-73346779 GCAGGAGGGAAGGGCCAGGAGGG + Intronic
1086228088 11:84536733-84536755 GCAGCAGGCAAAAGACAGGATGG - Intronic
1086983236 11:93221649-93221671 GCACGAGGCAAGGTACAGGCAGG - Intergenic
1087236740 11:95727710-95727732 GCAGGGGGCAGGAGGCAGGAGGG + Intergenic
1088506186 11:110529884-110529906 AGGGGAGGCAAGAGCCAGGGTGG + Intergenic
1088713926 11:112532103-112532125 CCAGGAGCCAAGACCCAGCCTGG - Intergenic
1089063399 11:115644239-115644261 GCAGGAGGCAAGAAGGAGGTGGG + Intergenic
1089358245 11:117869874-117869896 GCTGGAGGACAAAGCCAGGCCGG - Intronic
1089663334 11:120000295-120000317 GCAAAAGGCAAGGGTCAGGCTGG + Intergenic
1089666788 11:120025750-120025772 GCAGGAGCCGAGAGCGAGCCAGG - Intergenic
1089835070 11:121363240-121363262 GGAGGAGGCAGGAGCGAGGAGGG - Intergenic
1090198819 11:124839563-124839585 GGAGGAGGCGGGAGCCCGGCGGG + Intergenic
1090387423 11:126365059-126365081 GCAGGAGGAAACAGCCATGCAGG + Intronic
1090389989 11:126382257-126382279 GCAGGAGGAAACAGCCATGCAGG + Intronic
1090473190 11:126997955-126997977 GCAGGAGGCAGGGGTCAAGCAGG + Intronic
1090485367 11:127107797-127107819 GCAGGAGGTGAGTGGCAGGCGGG + Intergenic
1090748270 11:129724168-129724190 GCAGGTGGCAGGACCCCGGCAGG - Intergenic
1091188547 11:133669584-133669606 TCAGGAGGAAAGAGCCAAGCTGG + Intergenic
1091219098 11:133920037-133920059 GCAGGAGGCCCGGGCGAGGCCGG + Exonic
1202815128 11_KI270721v1_random:43643-43665 GCGGCAGGGCAGAGCCAGGCTGG + Intergenic
1092149423 12:6236835-6236857 GCAAGAGGGCAGAGGCAGGCGGG - Intronic
1092284086 12:7118957-7118979 GCAGGAGACCAGGGCCAGGAGGG + Intergenic
1092458500 12:8666135-8666157 GCAGGAGGCGACATCTAGGCCGG - Intergenic
1092659518 12:10723098-10723120 GGAGGAGGCATGAGTGAGGCGGG - Exonic
1094582700 12:31749077-31749099 GCAGTGGGCAAGAACCAGTCAGG - Intergenic
1095966950 12:47874497-47874519 GCAGGGGGCAAAAGGTAGGCTGG - Intronic
1096464808 12:51842416-51842438 GCAGAAGGCAACAGACAGGCTGG + Intergenic
1096483402 12:51958811-51958833 GCAGGAGGTAAGTGGCAGGCGGG - Intronic
1096543942 12:52324135-52324157 CCAGGAGGGAAGAGGCAGCCTGG - Intergenic
1096551134 12:52372439-52372461 GAAGCAGGAAAGAGCCAGGGAGG - Intergenic
1097601162 12:61694803-61694825 TAAGGAGGCAACAGCCAGTCTGG + Intergenic
1097688849 12:62715314-62715336 GCAGGAGGTGAGAGCCAAGGGGG + Intronic
1098149346 12:67530347-67530369 GCAGGAGGAGAGGGGCAGGCTGG + Intergenic
1100361849 12:93886455-93886477 GTAAGAAGCAAGAGGCAGGCTGG - Intronic
1101293603 12:103397368-103397390 ACAGGAGGTGAGTGCCAGGCTGG + Intronic
1101306003 12:103528582-103528604 GGAGGAGGCAAGAGAGAGGAGGG - Intergenic
1101364173 12:104056137-104056159 GCAGCTGGCAAGAGCAAGGCAGG - Intronic
1101749449 12:107571485-107571507 CCAAGAGGCAAAAGCCAGGGTGG - Intronic
1102959646 12:117084525-117084547 GGGGGAGGCCAGGGCCAGGCAGG - Intronic
1103282471 12:119771448-119771470 GCAGTAGTCAAGAGCCAGTCTGG + Intronic
1103564076 12:121806674-121806696 GGAAGAGGGAAGAGCCAGGCAGG + Intronic
1103917964 12:124385641-124385663 CCAGGAGGCATGGGCCAGGGAGG - Intronic
1103928758 12:124438001-124438023 GCAGGAGGGAAGCGGCAGACAGG + Intronic
1104643978 12:130484223-130484245 TCAGGAGGCAAGAGGCAGTCAGG - Intronic
1104706567 12:130951820-130951842 GCGGGAGGGCAGAGCCAGGCTGG + Intergenic
1104904990 12:132208330-132208352 GAAGGAGGCCGGAGCCCGGCTGG + Intronic
1104910846 12:132240305-132240327 GCCAGAGGCCAGAGCCGGGCCGG - Intronic
1104921276 12:132291989-132292011 GCAGGAAGCAGGAGCGTGGCTGG - Intronic
1105817627 13:24051429-24051451 ACTGGAGGCGAGAGCCTGGCAGG - Intronic
1105828413 13:24143075-24143097 GCAGCAGGCGAGAGGCAGGAAGG + Intronic
1106217451 13:27715846-27715868 GATGGAGGCAAGAGTCAAGCAGG + Intergenic
1107726286 13:43303194-43303216 ACAGGAGGGCAGAGGCAGGCTGG + Intronic
1108072964 13:46648332-46648354 GCAGGAGGTGAGTGTCAGGCTGG - Intronic
1108608201 13:52061300-52061322 GCAGGAGGTGAGTGGCAGGCAGG - Intronic
1108867360 13:54939392-54939414 GCAGGTGTCAAGGGCCAGGGGGG + Intergenic
1108970966 13:56376204-56376226 ACAGGAGTCAAGAACTAGGCTGG + Intergenic
1109280444 13:60349598-60349620 GAAGGAGGAGAGAGCCAGGAGGG + Intergenic
1111419028 13:87985571-87985593 GCAGGAGGTAAGTGGCAGGTGGG - Intergenic
1111677085 13:91399947-91399969 ACAGGAAGCAAGATCCACGCTGG - Intronic
1111703670 13:91721620-91721642 GGATGAGGCAAGAGGCAGACTGG - Intronic
1111886808 13:94031637-94031659 GCAGCATGCAAAAGCTAGGCTGG - Intronic
1112032991 13:95474392-95474414 GCAGGAGGTGAGTGGCAGGCAGG - Intronic
1112276565 13:98026733-98026755 GCAAGGGGCCACAGCCAGGCAGG - Intergenic
1112386605 13:98945975-98945997 GCAGGGGGCAAGAGATAGCCAGG + Intronic
1112771684 13:102800045-102800067 GCAGCTGGCAAGAGGGAGGCAGG - Intronic
1112931081 13:104738964-104738986 GCAGGAGGGGAGTGACAGGCCGG - Intergenic
1113551737 13:111197917-111197939 CCAGGAGGCAAGGGTCAGGATGG + Intronic
1113756120 13:112812339-112812361 GGAGTTGGAAAGAGCCAGGCAGG - Intronic
1113896052 13:113765115-113765137 GCAAGGGTCAAGAGGCAGGCAGG + Intronic
1113906387 13:113821195-113821217 GCAGGAGGCATCTGCCAGCCTGG + Intronic
1113925680 13:113940240-113940262 GCAGGAGGCCAGAGCCAGGTGGG + Intergenic
1113978319 13:114249385-114249407 GCAGGAGGTGAGTGGCAGGCAGG - Intronic
1114495021 14:23126474-23126496 GCAGGAGGCAGGGGCAGGGCTGG + Exonic
1114643131 14:24237996-24238018 GGAGAAAGCAAAAGCCAGGCAGG + Intronic
1118139107 14:63060490-63060512 GTAGCCGGAAAGAGCCAGGCTGG + Intronic
1118322468 14:64761384-64761406 ACAGGGGGAAAGAGCCAGGGCGG + Intronic
1118773926 14:68961763-68961785 GCAGGAGCCATGACCCTGGCTGG + Intronic
1119056643 14:71428788-71428810 ACAGCTGGCAAGAGCCAGGATGG - Intronic
1120679586 14:87464159-87464181 GCAGCAGGCAAGAGAGAGGCGGG - Intergenic
1120755585 14:88241255-88241277 GCAGGAGTTAAGAGCCATCCTGG + Intronic
1120826558 14:88961460-88961482 GCTGGAGCCAGGAGACAGGCTGG + Intergenic
1121303513 14:92890346-92890368 GCAGGCAGCCAGGGCCAGGCTGG - Intergenic
1121308990 14:92924614-92924636 CGGGGAGGCCAGAGCCAGGCAGG - Intronic
1121584925 14:95056752-95056774 GCAGGTGACAAAAGCCAGGGTGG + Intergenic
1122027625 14:98889014-98889036 GTAGGAGATAAGGGCCAGGCTGG - Intergenic
1122042390 14:98998059-98998081 AGAGGAGGCAGGAGCCAGGCAGG + Intergenic
1122276725 14:100594517-100594539 GCAGGAGGCAGGAGCCATCCTGG + Intergenic
1122324917 14:100876129-100876151 GCAGGAGGGATGAGCGAGTCCGG + Intergenic
1122347279 14:101068376-101068398 GCAGGAGGCACGAGTCAGTTGGG + Intergenic
1122672393 14:103382740-103382762 GCAGAAGGCCGGAGCCAGGCAGG - Intergenic
1122974652 14:105166115-105166137 GCTGGAAGCAAGAGGCAGGGAGG + Intronic
1123044979 14:105507533-105507555 CCAGGAGGTAGGAGCCAGACAGG - Intergenic
1124028711 15:25989930-25989952 GCAGGAGGCCTGGGGCAGGCAGG + Intergenic
1124045007 15:26140605-26140627 GGAGGAGGCAAGAGAGAGGCGGG - Intergenic
1124621357 15:31275861-31275883 GCAGGAGGCCAGCCCCAGGTTGG - Intergenic
1125092294 15:35808610-35808632 GCTGGACGCAAGAGACAGGAAGG - Intergenic
1125454457 15:39843101-39843123 GCAGGAGGGAAGAGTCATGGTGG + Intronic
1125465527 15:39947801-39947823 GTAGGAGGCAAGAGTCAGTTTGG + Intronic
1125608987 15:40958289-40958311 ACAGGAGACACGAGCCAGACAGG + Intergenic
1126494091 15:49271245-49271267 ACAGGAGGCAGGAGCCTGGCCGG - Intronic
1128091115 15:64919574-64919596 GCTGGAAGCAAGAGCCAGCAGGG - Intronic
1128685201 15:69679102-69679124 CCAGGAGGCAGGAGCCATGGTGG + Intergenic
1128760913 15:70215445-70215467 GCTGGAGGCCAGAGCCAGAAGGG - Intergenic
1128998184 15:72312188-72312210 GCAGGAGGTGGGAGCCAGGTGGG + Intronic
1129207894 15:74048102-74048124 GCTGGAGCTAAGAGCCAGGTTGG - Intergenic
1129252135 15:74314900-74314922 GCAGAAGCCCACAGCCAGGCAGG + Intronic
1129268507 15:74407554-74407576 GCAGGAGGCTTGTGCCTGGCTGG + Intergenic
1129385961 15:75196182-75196204 GCAGGCAGCATGAGGCAGGCAGG + Intronic
1130980035 15:88805997-88806019 ACAGTCGGCAAGAGCCAGGAGGG + Intronic
1131261841 15:90891689-90891711 ACAGGTGGCATGGGCCAGGCTGG - Intronic
1131293114 15:91124411-91124433 GCAGCAGCCAAGAGCCAGTGAGG + Intronic
1131533077 15:93211249-93211271 CCCGGAGGCAAGAACCAGCCTGG - Intergenic
1132081573 15:98870475-98870497 CAAGGAGGCATAAGCCAGGCAGG + Intronic
1132807605 16:1782315-1782337 GCGGGAGGGAACAGCCAGGCCGG - Intronic
1132956975 16:2599468-2599490 GCAGCAGCCAAGGCCCAGGCAGG - Exonic
1132969326 16:2677921-2677943 GCAGCAGCCAAGGCCCAGGCAGG - Intergenic
1133271304 16:4612005-4612027 GCAGGCCCCAGGAGCCAGGCTGG - Intronic
1134198574 16:12178474-12178496 ACAGAAGACAAAAGCCAGGCTGG - Intronic
1134201830 16:12205546-12205568 GCCTGAGGCAGGAGCCAGCCTGG - Intronic
1134211243 16:12279441-12279463 GGATGAGTCAAAAGCCAGGCTGG + Intronic
1134518833 16:14908550-14908572 GCAGGAGGGCAGAGCCAGCCTGG - Intronic
1134555095 16:15157674-15157696 GCAGGAGGGCAGAGCCAGCCTGG + Intergenic
1134706504 16:16307205-16307227 GCAGGAGGGCAGAGCCAGCCTGG - Intergenic
1134961036 16:18404919-18404941 GCAGGAGGGCAGAGCCAGCCTGG + Intergenic
1134965338 16:18487522-18487544 GCAGGAGGGCAGAGCCAGCCTGG + Intronic
1135015667 16:18922986-18923008 GCAGGAGGCTTGAGCCTGGGAGG + Intronic
1135321287 16:21498793-21498815 GCAGGAGGCTTGAGCCTGGGAGG + Intergenic
1135374120 16:21930295-21930317 GCAGGAGGCTTGAGCCTGGGAGG + Intergenic
1135437666 16:22440426-22440448 GCAGGAGGCTTGAGCCTGGGAGG - Intergenic
1135954116 16:26941220-26941242 GGAGGAGGGAGGACCCAGGCAGG - Intergenic
1136231182 16:28886416-28886438 CCAGGGGGCAAGGGCTAGGCTGG + Intronic
1136288165 16:29256156-29256178 GCATCAGGCAGAAGCCAGGCAGG + Intergenic
1136332764 16:29591916-29591938 GCAGGAGGCTTGAGCCTGGGAGG + Intergenic
1136362696 16:29790994-29791016 GGAGAAGGCAGGAGCCAGGCGGG - Intronic
1136363254 16:29795437-29795459 GCAGAAGGCAAAAGGCTGGCTGG - Intronic
1136447458 16:30332004-30332026 GCAGGAGGCTTGAGCCTGGGAGG + Intergenic
1136641563 16:31569484-31569506 GGAGGAGGCATGAGCGAGGCGGG - Intergenic
1137218935 16:46427965-46427987 GCAGGAGCCAAAAGCCACGGTGG + Intergenic
1137618664 16:49861422-49861444 GGAGGAGGAAGGAGCCAAGCGGG + Intergenic
1138091047 16:54174874-54174896 GCAGGAGGCAAGAGAGAAGTAGG - Intergenic
1138483115 16:57317226-57317248 GCAGGGGGCAAGGCCCTGGCTGG + Intergenic
1139635461 16:68255744-68255766 TCTGCAGGCCAGAGCCAGGCAGG - Exonic
1139947554 16:70651569-70651591 GCAGGAGGCCTGAGCAGGGCAGG + Intronic
1140221181 16:73045488-73045510 CCTGGTGGGAAGAGCCAGGCAGG + Intronic
1140278152 16:73529524-73529546 CCAGGAGGCAGGAGCCAAGCAGG - Intergenic
1140457281 16:75112747-75112769 GCAGGAGGCAAGAGGAGGACTGG - Intronic
1140781883 16:78304393-78304415 GCAGAAGGCAACAGCATGGCTGG - Intronic
1141638927 16:85329916-85329938 GCAGGGGGCAAGAGGCTGGTGGG + Intergenic
1142007606 16:87697142-87697164 GCAGGAGGCATGGGGCAGGGTGG + Exonic
1142194787 16:88734369-88734391 GCGGGAGGCGCGTGCCAGGCAGG + Exonic
1142805609 17:2369709-2369731 GCAGCAGGCAACAGGCGGGCAGG - Intronic
1143181917 17:4988691-4988713 GCAGAAGCTGAGAGCCAGGCTGG - Intronic
1143183268 17:4997144-4997166 GCTGGAGGGAAGCGCCGGGCCGG + Intronic
1143583999 17:7842424-7842446 GCACGCGGCCAGAGCCAGGCTGG - Intronic
1143711529 17:8739289-8739311 GCAGGAGGGAGGAGCCAAGGAGG + Intronic
1143968692 17:10776466-10776488 GCAGGTGACCTGAGCCAGGCAGG + Intergenic
1144436602 17:15248116-15248138 CCAGGGGGCAAGACCCACGCTGG - Intronic
1144438976 17:15264690-15264712 GCAGGAGGCCAGAGGCAGTGAGG - Intronic
1144542137 17:16154634-16154656 GTATGGGGCAAGGGCCAGGCGGG + Intronic
1145102452 17:20088387-20088409 GCAGAAGCCAAGAGCCAGTGAGG + Intronic
1145280312 17:21463196-21463218 GGAAGAGACAAGATCCAGGCAGG + Intergenic
1145736817 17:27238892-27238914 GCAGGAGGCATGGGCCAGGTGGG + Intergenic
1145770118 17:27486734-27486756 GTAGGAGGCACAAGCAAGGCGGG + Intronic
1145941796 17:28746638-28746660 GCAGGTGGCAAGGGCCGGGTGGG + Intronic
1146053455 17:29569225-29569247 GCAGGCCCCAAGCGCCAGGCTGG - Intronic
1146510948 17:33448146-33448168 GTAGGAGGCAAGAGTCAGAGAGG - Intronic
1147310513 17:39593374-39593396 GCAGATGGCAAGAGTAAGGCAGG + Intergenic
1147324794 17:39665060-39665082 GCAGAGGGCAAGTGCCAGGGGGG + Exonic
1147453626 17:40521096-40521118 GCAGGCGGCAACAGACAGGCTGG - Intergenic
1147925323 17:43942289-43942311 GCAGAAAGCAAGACCCAAGCAGG + Intronic
1147971672 17:44221554-44221576 GCAGGAGGCAGGAGGCAGCGGGG - Exonic
1148053279 17:44779621-44779643 GCAGGCGGCAAGTCACAGGCTGG - Intronic
1148081156 17:44968267-44968289 GCAGGAGGGAGGCGCGAGGCAGG - Intergenic
1148086505 17:44996821-44996843 GCAGGAGGCAGGAGTTAGTCTGG + Intergenic
1148127431 17:45244070-45244092 GCAGGAGGCAACTCCCAGCCTGG + Intronic
1148218411 17:45846438-45846460 GCAGGCAGCCACAGCCAGGCTGG - Exonic
1148767808 17:50049441-50049463 GCTGGAGGCAAGAGGAAGACTGG + Intergenic
1148770554 17:50063704-50063726 CCAGGAAGCAAGAGCCAGCAGGG - Intronic
1149320040 17:55473156-55473178 GCAGGAGGCAAGCCAGAGGCTGG - Intergenic
1149503680 17:57175102-57175124 GGAGGAGGCAGGAGCCAGGCAGG + Intergenic
1150003487 17:61456034-61456056 GCAGGAAAGGAGAGCCAGGCTGG - Intronic
1150105894 17:62462244-62462266 GCAGGACAAAAGAGCCAGCCAGG + Intronic
1151032088 17:70753128-70753150 GCAGGAGGTGAGTGGCAGGCAGG + Intergenic
1151214187 17:72566345-72566367 GCAGCAGCCATGTGCCAGGCAGG + Intergenic
1151231210 17:72686451-72686473 GAACGAGCCAAGAGCCATGCTGG - Intronic
1151333353 17:73424202-73424224 ACTGCAGGCAACAGCCAGGCAGG + Intronic
1151375084 17:73682933-73682955 GGAGGAGGGCAGAGCCTGGCTGG - Intergenic
1151377212 17:73698057-73698079 TCACGAGGAAAGAGCCAGGCAGG - Intergenic
1151379866 17:73718370-73718392 GCAGGAGGGAGAAGCCAGCCTGG + Intergenic
1151457853 17:74237261-74237283 GCAGGGGGCAAAAGCCATGGAGG - Intronic
1151583044 17:74990930-74990952 GCAGGAGGAAACAGACAGGAGGG - Intronic
1151682559 17:75629579-75629601 GTGGGAGGGAAGAGGCAGGCAGG + Intronic
1151713513 17:75819832-75819854 GCAAGGGGCCTGAGCCAGGCAGG - Intronic
1151728313 17:75896943-75896965 GGCGGCGGCGAGAGCCAGGCGGG + Exonic
1152241248 17:79162403-79162425 GCTGGAGGCAGGAGAGAGGCAGG - Intronic
1152510465 17:80783599-80783621 GCTGGATGCATGAGCCTGGCCGG - Intronic
1152750589 17:82060765-82060787 GCAGGAGGAGATATCCAGGCAGG - Exonic
1152795137 17:82302868-82302890 CCAGGAGGCCTGAGGCAGGCGGG + Intergenic
1153226847 18:2906495-2906517 GCCGGAGCCAAGAGTGAGGCCGG + Intronic
1153476266 18:5502030-5502052 GCAGGAGGCAGGAGGCAGGAGGG - Intronic
1154175667 18:12086366-12086388 GCAGGTGGCAGCAGCCAGGGTGG + Intergenic
1155523767 18:26695821-26695843 GCAGGAGGCTTGAGCCTGGGAGG + Intergenic
1156262540 18:35458815-35458837 CCAGAAGGCAGGAGCCAGGTGGG + Intronic
1157109013 18:44802038-44802060 AAAGGAGGCAAGTGCCAGGTGGG - Intronic
1157860144 18:51133773-51133795 GCAGCAGGCCATGGCCAGGCAGG + Intergenic
1158783880 18:60685408-60685430 GCCAGAGGCAAGGGCAAGGCAGG + Intergenic
1159027703 18:63201063-63201085 GCAGAAGTCAAGTGACAGGCTGG + Intronic
1159884828 18:73893940-73893962 GCAGGACGCAAGAGCTCTGCTGG + Intergenic
1160222397 18:76986640-76986662 CTAGGACGCAAGAGCGAGGCTGG - Intronic
1160418307 18:78727062-78727084 GGAGGTGGCAGGCGCCAGGCAGG - Intergenic
1160721316 19:598090-598112 GCAGGGGGCCAGCGGCAGGCGGG + Intronic
1160785080 19:896587-896609 CCAGGCTGCAGGAGCCAGGCTGG - Exonic
1161266216 19:3366041-3366063 GTTGGAGGAAAGAGCCAGGGGGG - Intronic
1161792786 19:6370658-6370680 GTGGGAGCCAAAAGCCAGGCTGG + Intergenic
1162308381 19:9889663-9889685 GCAGTGGGCCAGACCCAGGCAGG + Intronic
1162498191 19:11035159-11035181 GCCGCAGGCCAGCGCCAGGCAGG + Intronic
1162502385 19:11061300-11061322 TCAGGGGCCAAGGGCCAGGCAGG + Intronic
1162926822 19:13934435-13934457 GTAGGAGGCGAGGGGCAGGCTGG - Intronic
1163148650 19:15398739-15398761 GGAGGAGGCAAGCGCCAGTGCGG + Intronic
1163569659 19:18073450-18073472 GCAGGAGGCAAAAGCCTAGGCGG - Intronic
1165479171 19:36051834-36051856 GCAGGAGGTGAGTGGCAGGCAGG + Intronic
1166297725 19:41897104-41897126 CCAGGAGGCAGGAGCGAGGCGGG - Intronic
1166540981 19:43605719-43605741 GGAGGAGGCAGGAGCCTGCCTGG - Intronic
1166781408 19:45345409-45345431 GGAGCAGGGAAGAGCCAGGATGG + Intronic
1166935416 19:46329523-46329545 GCAGGAGGCAGGGGCAAGACGGG - Intronic
1167157764 19:47749942-47749964 GCAGGAGGCAGGCCCCATGCTGG - Intronic
1167268186 19:48493624-48493646 GCAGGAGCCTAGAGCCGGGAAGG - Intronic
1167463421 19:49638216-49638238 GCAGCGGGCAGGACCCAGGCAGG - Intronic
1167616473 19:50537048-50537070 GGACAAGGCCAGAGCCAGGCTGG + Intronic
1167617241 19:50542184-50542206 GAAGGAGGAAGGAGCCAGTCCGG + Intronic
1167639772 19:50674440-50674462 GCTGGAGGAAAGAGGCAGGAGGG - Intronic
1167667356 19:50830543-50830565 GCAGCAGGCAGGCGCGAGGCAGG + Intronic
1168012747 19:53546387-53546409 GGATGTGGCAAGGGCCAGGCAGG + Intronic
1168294016 19:55370066-55370088 GCAGGAGGGACGGGCCAGACAGG - Intronic
1168352716 19:55685850-55685872 GCACGAGGCAAGAGGCAGGAAGG - Intronic
1168708425 19:58482778-58482800 GCAGGAGGCGAGAGCTGTGCTGG + Intronic
1168719777 19:58548645-58548667 GCAGGAGAGAGGACCCAGGCAGG + Intronic
925053942 2:841042-841064 GCAGGAGGGAAGAGCCATGCAGG + Intergenic
925198766 2:1949387-1949409 CCAGGAGGCATGGCCCAGGCTGG - Intronic
926005985 2:9373775-9373797 GAATCAGGCAAGAGCCAGGCAGG - Intronic
926110578 2:10180584-10180606 GCAGGAGGCAGGAGCCCTGGAGG - Intronic
926693086 2:15750925-15750947 GCAGTAGGCTGGAGGCAGGCAGG - Intergenic
927465616 2:23334263-23334285 CTAGGAAGCAAGAACCAGGCGGG + Intergenic
927472379 2:23385774-23385796 GCCGGAGGTAAGAGCCGGGCCGG + Exonic
927495035 2:23546392-23546414 GGAGGAGGCAAGAGCTGAGCTGG + Intronic
927673598 2:25089121-25089143 GCAGGAGGCAGCAGCCTGTCTGG + Intronic
927937282 2:27082978-27083000 GCAGGTGGCAGGGGCCATGCAGG + Exonic
928091043 2:28375336-28375358 GCAGGGGGCAGGAGCCCAGCAGG + Intergenic
929610520 2:43267617-43267639 GCAGGAGGGAAGGGCCAGCCTGG - Intronic
930034000 2:47074450-47074472 GCAGGGGGAAAGAGCAAGGTGGG - Exonic
930274573 2:49296719-49296741 GCAGGGAGGTAGAGCCAGGCAGG - Intergenic
930750357 2:54928523-54928545 GCAGGAGGCATGTGGCAGGTGGG - Intronic
931358145 2:61554934-61554956 GCAGCAGGCAAGTCCCAGGATGG - Intergenic
932365575 2:71150896-71150918 GCAGCAGGGTAGAGCTAGGCTGG + Intergenic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
932691248 2:73915559-73915581 GCAGATGGCAAGAGCCAGTTTGG + Intronic
933158310 2:78997954-78997976 CCAGCAGGCAAGAGTGAGGCAGG + Intergenic
933720579 2:85395026-85395048 GGAGGGGGCCAGAGCCAGGGAGG + Intronic
933806224 2:85999723-85999745 GCAGGAGGAAAGAGCCATCCTGG + Intergenic
934331595 2:92074118-92074140 GCAGGAGCCAAAAGCCACGGTGG - Intergenic
934678822 2:96267918-96267940 TCAGGAGGTAAGAGTCAAGCAGG + Exonic
934755329 2:96820539-96820561 GGAGGAGGCAAGACCAAGGAAGG + Intronic
934950109 2:98570383-98570405 GAAGAAGGCAGGAGCCAGGAGGG + Intronic
935987490 2:108688881-108688903 GCTGGAGGCAAGAGTGAGGAAGG + Intergenic
936126316 2:109791578-109791600 GCTGGAGGCAAGAGTGAGGAAGG + Intergenic
936153282 2:110033107-110033129 GGAGGAGGGAAGCACCAGGCCGG + Intergenic
936191399 2:110338308-110338330 GGAGGAGGGAAGCACCAGGCCGG - Intergenic
936218377 2:110579890-110579912 GCTGGAGGCAAGAGTGAGGAAGG - Intergenic
937897785 2:126991502-126991524 GTGGGAGGCAAGAGCGAAGCCGG + Intergenic
938464062 2:131515472-131515494 ACAGGAGGCACGAGCCAGGCCGG - Intergenic
938890399 2:135698723-135698745 GCAGAAGGCAAGAGGGAAGCAGG + Intronic
943129322 2:183837627-183837649 GATGGTGGCAAGAGGCAGGCAGG + Intergenic
944441632 2:199749214-199749236 GCTGGAGAGAAGAGACAGGCAGG - Intergenic
944936294 2:204572381-204572403 GGGGGAGGAAAGAACCAGGCTGG + Intronic
945067791 2:205961742-205961764 GCAGGAGGAATGAACCATGCAGG - Intergenic
945862556 2:215140349-215140371 GAAGCTGGCAAGAGCCAGGCTGG - Intergenic
946090593 2:217219306-217219328 AAAGGAGGCAAGATGCAGGCTGG + Intergenic
946172146 2:217901981-217902003 GAAGGAGGGAAGAGCCAAGTGGG + Intronic
946317630 2:218928195-218928217 GCAGCAAGCAGGCGCCAGGCAGG + Intergenic
946336692 2:219042356-219042378 GCTGGAGGGAAGGGGCAGGCAGG + Intergenic
946502778 2:220267415-220267437 GCAGGAGGTGAGGGGCAGGCAGG - Intergenic
947095091 2:226557593-226557615 GAAGGATGCAAGAGGCAGGAAGG - Intergenic
947426260 2:229985602-229985624 GCAGGAGGTAGGAGCCTGGGAGG + Intronic
948284298 2:236771970-236771992 CTAGAAGGCAAGAGCCAGGAGGG - Intergenic
948394927 2:237638425-237638447 GCAGGAGGTGAGCGGCAGGCGGG - Intronic
948577671 2:238965058-238965080 GGAGGAGGCAAGAGGCAGGAGGG - Intergenic
948577706 2:238965180-238965202 GCAGGAGGGAGGAGGCAGGAGGG - Intergenic
948663644 2:239521470-239521492 CCAGGAGCCAAGAGACAGGTGGG - Intergenic
948756067 2:240160381-240160403 GCAGGTGGCCAGAGCCTGGGGGG - Intergenic
948792990 2:240388780-240388802 GGAGGGGGCAAGGGCCAGCCTGG + Intergenic
948796672 2:240406483-240406505 GCAGGAGGAAGGAGAGAGGCTGG - Intergenic
948863381 2:240763626-240763648 GCAGGAGGCAAGTACAAGGCTGG - Intronic
948918333 2:241049746-241049768 GCGGGCGGCAAGAGGCTGGCGGG - Intronic
949023439 2:241753914-241753936 GGAGGAGGGCAGGGCCAGGCAGG + Intronic
1168819416 20:763033-763055 GCAGGAGGTTAGAGGCAGGAAGG + Intronic
1168976461 20:1969716-1969738 GCAGGAGGTGAGAGCCGGGCAGG - Intergenic
1169561165 20:6802527-6802549 GAGGGTGGCAAGAGGCAGGCAGG - Intergenic
1169999389 20:11597500-11597522 GCCGGAGGCAAAAGTCAGGGGGG + Intergenic
1170731934 20:18983545-18983567 GTAGGCAGCAAGAGGCAGGCAGG - Intergenic
1170886256 20:20342565-20342587 GAAGCAGGGTAGAGCCAGGCTGG - Intronic
1170914923 20:20613597-20613619 GGAGGAGGCAGGGGGCAGGCCGG - Intronic
1171389817 20:24794310-24794332 CCAGGAGGCAAGGGGCAGGGAGG - Intergenic
1171463261 20:25310591-25310613 GCAGAGGGCTAGGGCCAGGCTGG + Intronic
1171949879 20:31411963-31411985 GCAAGAGTCAATGGCCAGGCAGG - Intronic
1172093122 20:32447528-32447550 GCAGGAAGCCAGGTCCAGGCTGG + Exonic
1172227406 20:33314511-33314533 GTGGGTGGCAAGGGCCAGGCAGG - Intergenic
1172246149 20:33446390-33446412 GCAGGAGGCAAGAGACCAGCAGG + Intergenic
1173016667 20:39232131-39232153 GCAGGAAGCAGGAGCCAGTGTGG + Intergenic
1173105462 20:40129287-40129309 GAAGGAATCCAGAGCCAGGCTGG - Intergenic
1173629887 20:44504864-44504886 GCAAGAGGCCGGAGCGAGGCTGG + Exonic
1173733251 20:45342671-45342693 GCAGGAGGCAAGAACAAGGCTGG + Intronic
1173840046 20:46151218-46151240 GCAGGATGCAGCAGGCAGGCTGG + Intergenic
1174177211 20:48652646-48652668 CCAGGAAGCACGAGCCAGTCAGG - Exonic
1174814854 20:53677872-53677894 GCAGGTGGCAAAAGAGAGGCCGG - Intergenic
1175378910 20:58549129-58549151 CCACGAGGGAAGAGCTAGGCAGG - Intergenic
1175412202 20:58777735-58777757 GCAGGCAGCAGGGGCCAGGCTGG - Intergenic
1175637578 20:60598636-60598658 GCAGCTGGCGAGAGACAGGCTGG - Intergenic
1175891845 20:62319186-62319208 GCAGGAGGTGAGGGCCGGGCAGG - Intronic
1176147617 20:63572458-63572480 GCAGTAGGCAGGAGGCTGGCCGG + Intronic
1176388157 21:6150034-6150056 GCAGGAGGCAGGGGCCTGGCAGG - Intergenic
1177075964 21:16573778-16573800 GCAGGAGGAAAGGCTCAGGCTGG - Intergenic
1177831631 21:26145507-26145529 GCAGGAGGTGAGTGGCAGGCAGG - Intronic
1178239370 21:30881365-30881387 CCAGGAGCCAAGAGCCAGTCTGG + Exonic
1178781109 21:35604116-35604138 ACAGGAGGCAAAAGGGAGGCTGG + Intronic
1178824871 21:36006424-36006446 GCAGGTAGCAAAAGCCAGCCAGG + Intergenic
1178843777 21:36157475-36157497 GCAGGGCGCAGGGGCCAGGCTGG - Intronic
1178926668 21:36780958-36780980 GCAGGAGGTGAGAAGCAGGCAGG + Intronic
1178928407 21:36794888-36794910 GCAGGAGGCAAGGGCTGAGCAGG + Intronic
1179421237 21:41238395-41238417 GCAGGAGGAGGGAGGCAGGCAGG + Intronic
1179735315 21:43388214-43388236 GCAGGAGGCAGGGGCCTGGCAGG + Intergenic
1179818444 21:43922712-43922734 TCAGGAGCCATGTGCCAGGCAGG + Intronic
1179818459 21:43922777-43922799 TCAGGAGCCACGTGCCAGGCAGG + Intronic
1180042436 21:45287424-45287446 GCAGGGGGCAGGGGCCAGGAGGG - Intronic
1180060496 21:45382585-45382607 GCAGGAGGCCAGTGCCTGGTAGG + Intergenic
1180127153 21:45800557-45800579 GCAGGAGGCACCAGCAAGGCTGG - Intronic
1180153590 21:45965983-45966005 GCAGGAGGCAAAAGGAATGCAGG - Intergenic
1180646403 22:17342633-17342655 GCAGCAGGCAGGGGCCAGGAGGG + Intergenic
1180702175 22:17787298-17787320 GCTGCAGGACAGAGCCAGGCAGG + Intergenic
1180706936 22:17815971-17815993 GCAGGAAGCAGGAGACAGCCGGG + Intronic
1180820529 22:18824089-18824111 GCCTGAGGCCACAGCCAGGCTGG - Intergenic
1180983493 22:19890699-19890721 GCAGAAAGCAAGAACCAAGCTGG - Intronic
1181171639 22:21013216-21013238 GCAGGTGGCTATAGCCATGCAGG - Intronic
1181206753 22:21258561-21258583 GCCTGAGGCCACAGCCAGGCTGG - Intergenic
1181465483 22:23108473-23108495 GCAGGAGTCAGGAGACAGCCGGG + Intronic
1181679307 22:24481032-24481054 GACGCAGGCAAGATCCAGGCAGG + Intergenic
1181762464 22:25067659-25067681 ACAGGATGCCAGAGACAGGCGGG - Intronic
1181807586 22:25384380-25384402 GCTGGCTGCAGGAGCCAGGCTGG - Intronic
1182352518 22:29706790-29706812 CCAAGAGGCAGGGGCCAGGCAGG + Intergenic
1182358924 22:29735335-29735357 TCAGGAGGCAGGAGGAAGGCAGG + Intronic
1183162091 22:36121335-36121357 ACAGGAGGCCTGAGGCAGGCAGG + Intergenic
1183276421 22:36900935-36900957 CCAGGGGGCAGGAACCAGGCAGG - Intergenic
1183364128 22:37398309-37398331 GCAGGAGGGAGAGGCCAGGCTGG - Intronic
1183458647 22:37936396-37936418 GCGGGAGGCAAGATTCAGGAGGG - Intronic
1183779545 22:39989925-39989947 GAAGGAGGAGGGAGCCAGGCAGG + Intergenic
1183786215 22:40030542-40030564 GCAGGAGGCAAAGGCCAGTCTGG - Exonic
1183912936 22:41092396-41092418 GCCCGAGCCGAGAGCCAGGCTGG - Exonic
1183945080 22:41320849-41320871 GCAGGTGGGAGGAGCCAGGAAGG + Intronic
1184192585 22:42904746-42904768 GCAGGGGGCTAGGGCCAGGGTGG - Intronic
1184515477 22:44959405-44959427 GGAGGAGGAAGGACCCAGGCAGG - Intronic
1184636498 22:45836409-45836431 GCAGGAGGCAGGAGACAGGGAGG - Intronic
1184778384 22:46634513-46634535 GCAGGAGCCAGGTGCCAGCCTGG + Intronic
1184944579 22:47794073-47794095 GCAGGAGGTGGGAGCCAGGCAGG - Intergenic
1184967963 22:47995392-47995414 GAGGGAGGCAAGTGCAAGGCAGG + Intergenic
1184970452 22:48016325-48016347 GAAGGAGACAAAGGCCAGGCAGG - Intergenic
1185072674 22:48665968-48665990 GTAGGAGGCCAGGGCTAGGCTGG - Intronic
1185310259 22:50150375-50150397 GCAAGAGGCAAGGGGCAGGTGGG + Intronic
1185313778 22:50170335-50170357 GCCGGAGGCACGCGCCAGGGCGG + Intergenic
1185384418 22:50525335-50525357 GCTGGAGGCCGGAGCGAGGCTGG - Intronic
1203220171 22_KI270731v1_random:36862-36884 GCCTGAGGCCACAGCCAGGCTGG + Intergenic
1203270655 22_KI270734v1_random:49964-49986 GCCTGAGGCCACAGCCAGGCTGG - Intergenic
950024350 3:9810238-9810260 GCAGGCGGCAGATGCCAGGCGGG + Exonic
950152528 3:10698704-10698726 ACTGGAGGCACGAGCCAGCCTGG + Intronic
950576550 3:13835493-13835515 GGGGGTGGCCAGAGCCAGGCAGG - Intronic
950621887 3:14212636-14212658 GCAGGAGGCAAGAGAGTGGCAGG + Intergenic
952268920 3:31813734-31813756 GCAGGTGGGAGCAGCCAGGCTGG - Intronic
952968816 3:38637823-38637845 ACAGGACACAATAGCCAGGCAGG + Intronic
952977607 3:38709394-38709416 TCAGGAGGCCAGAGCTGGGCAGG + Intronic
953005276 3:38971936-38971958 GCAGGAGGCAGGAGGAAGGAGGG + Intergenic
953025692 3:39143675-39143697 GCTGGAAGCCAGGGCCAGGCAGG + Exonic
953251261 3:41247303-41247325 GCTCCAGGCAGGAGCCAGGCAGG - Intronic
953391376 3:42535870-42535892 GCAGGAGGTAAGAGGCAGAGAGG - Intronic
953932744 3:47013915-47013937 ACAGGAGGCAAGAAGCAGGCTGG + Intergenic
954082735 3:48222021-48222043 GATGGCGGCAGGAGCCAGGCAGG + Intergenic
954422983 3:50428403-50428425 GCAGGAGGTGTGAGCCAGGGAGG - Intronic
954716061 3:52527516-52527538 GCAGTGGGCAAGGGCCAGGTTGG + Intronic
955219081 3:57009031-57009053 ACAGGAGGCAGGAACCAGGATGG + Intronic
959619562 3:108385526-108385548 AGAGGAGGCTAGAGGCAGGCAGG + Intronic
960700981 3:120439127-120439149 GGAGGAGGCGAGAGCAAGGCCGG + Intronic
961427389 3:126858729-126858751 AGAGGAGGCAAGAGCCCAGCGGG - Intronic
961446245 3:126983064-126983086 GCGGGCGGCGAGAGCGAGGCCGG + Intergenic
961521835 3:127471555-127471577 GAGGGAGGAAAGAGACAGGCAGG + Intergenic
961562227 3:127738549-127738571 GCAGGAGCCATCTGCCAGGCTGG + Intronic
961640190 3:128360290-128360312 GCAGGGGGCATGAGCCAGACAGG + Intronic
961669224 3:128516946-128516968 GAAGGGGGCATGAGCCAGGCAGG + Intergenic
961786167 3:129348102-129348124 CCAGGAAGCAAGAGGCGGGCTGG + Intergenic
962454246 3:135550493-135550515 GAGGGAAGCAAGAGGCAGGCAGG + Intergenic
962855170 3:139338821-139338843 GCAGGAAGCCAGAGCCAGAAAGG - Intronic
962975912 3:140445642-140445664 GCAGGAGTGAAGATACAGGCCGG + Intronic
963147333 3:142007914-142007936 GCAGGAGGTGAGTGGCAGGCAGG - Intronic
963200188 3:142578611-142578633 GGAGGATGCAGGACCCAGGCTGG + Intronic
964720492 3:159764269-159764291 GCAGGAGGGAAGCCTCAGGCTGG + Intronic
965673480 3:171171403-171171425 GCAGGAGGCTGGGTCCAGGCTGG + Intronic
965684113 3:171283571-171283593 ACAGGGGGCAGGAGCCAGGTTGG - Intronic
965771152 3:172182279-172182301 GGAGGAAGCATGAGTCAGGCTGG + Intronic
966807800 3:183820020-183820042 TCAGGTGGAAGGAGCCAGGCTGG + Intronic
967461974 3:189758287-189758309 GCAGGAGGTGAGAGGTAGGCAGG - Intronic
968007863 3:195255283-195255305 GCAGGAGTGCAGAGCCAGGTGGG + Intronic
968512094 4:1000286-1000308 CCAGGGGTCAGGAGCCAGGCAGG - Intronic
968568387 4:1326900-1326922 GCAGCAGGCAGGACCCAGGTCGG - Intronic
968616663 4:1580600-1580622 GCAGGAGGCAGGGCCTAGGCGGG - Intergenic
968715797 4:2158527-2158549 GCAGGGAGAAAGGGCCAGGCTGG + Intronic
968862609 4:3184661-3184683 GCAGGAGGTCAGAGCCTGTCTGG + Intronic
968939499 4:3630700-3630722 CCAGGAGGCATCAGCCAGGGCGG + Intergenic
969095379 4:4728929-4728951 GCAGCAGCCAGGAGCCATGCTGG - Intergenic
969453286 4:7286990-7287012 GGAGGAGGCAACTCCCAGGCCGG - Intronic
969486505 4:7475221-7475243 GCAGGTGGAAAGTCCCAGGCAGG + Intronic
969710483 4:8840470-8840492 GGATGGGGCAAGAGCCAGGGTGG - Intergenic
970038652 4:11770682-11770704 GGAGGAGGTAAGTGGCAGGCAGG + Intergenic
970236135 4:13960043-13960065 GCAGGAAGCAGGAGGCAGGAGGG + Intergenic
970907382 4:21231774-21231796 TCAGGAGGCAAGAGAGAGGGCGG + Intronic
971216900 4:24670533-24670555 GCAGGAGGAGAGAGAGAGGCAGG + Intergenic
972270120 4:37502733-37502755 GCAGGAGGGAGTAGGCAGGCTGG + Intronic
974725014 4:65787378-65787400 GCAGAAGGCAAGATCCAGAAGGG + Intergenic
974809041 4:66921696-66921718 GGAGGAGACAAGAGACAGGAAGG + Intergenic
975415256 4:74098386-74098408 GCAGGAGGGAAGAACCTGGGTGG + Intronic
976608636 4:87006852-87006874 GCAGGCGGCAAGCGGCAGGCAGG - Intronic
979258866 4:118631200-118631222 ACAGGAGGCAGGAGCTGGGCCGG - Intergenic
979329484 4:119409357-119409379 ACAGGAGGCAGGAGCTGGGCCGG + Intergenic
980975386 4:139605709-139605731 GCTGTGTGCAAGAGCCAGGCAGG + Intronic
984820257 4:183875763-183875785 GCAGGAGTCAAGTGCCATGATGG + Intronic
985534626 5:457070-457092 GCAGCAGGCAGGAGGCAGGGGGG + Intronic
985650861 5:1106742-1106764 GCCACAGGCAAGAGTCAGGCTGG + Intronic
985801646 5:2008341-2008363 GCAGGAGGGAACAGACAGGCGGG + Intergenic
986600490 5:9467777-9467799 GCAGGACGCCAGACCCACGCTGG - Intronic
986878736 5:12143446-12143468 GAAGAAGGCAAGAGCCAGAATGG + Intergenic
987066593 5:14296041-14296063 GCAGGCAGCAAGAGACAGGAAGG + Intronic
988179081 5:27766516-27766538 TTAGGAGGCATGAGCCGGGCAGG + Intergenic
988672890 5:33400956-33400978 GCAGAAGGCAAGAGGGAAGCAGG - Intergenic
990475957 5:56162083-56162105 GGAGGAGGGAAGGGCAAGGCAGG + Intronic
991410682 5:66342462-66342484 CCAGGAGCCAAGAGCCATGTAGG - Intergenic
992030955 5:72721084-72721106 TGAGGAGGGAGGAGCCAGGCTGG - Intergenic
994076681 5:95659735-95659757 GAAGGAGGCAGGAGGCAGGAGGG - Intronic
995565089 5:113426019-113426041 GGAGCAGACAAGAACCAGGCAGG + Intronic
995804570 5:116037154-116037176 ATGGGAGGCAAGAGCCATGCTGG - Intronic
996923883 5:128800175-128800197 GCAGGAGGCAAATTCCTGGCTGG - Intronic
997370068 5:133353914-133353936 TCAGCAGGGAAGAGCCAAGCAGG - Intronic
997460261 5:134047118-134047140 GCAGTAGACCAGAGCCAGGGGGG + Intergenic
997594082 5:135094804-135094826 GCAGGAGGCCAGACCCAGGCAGG - Intronic
998845841 5:146308954-146308976 GCAGCAGGCAGGAGGCAGGAAGG + Intronic
1000130083 5:158288750-158288772 GCATGAGGCAGCAGCTAGGCAGG + Intergenic
1001314244 5:170631502-170631524 GCAGGAGGCAAAAGAAACGCAGG + Intronic
1001413792 5:171528997-171529019 GCAGGAGTGGGGAGCCAGGCTGG - Intergenic
1001482543 5:172098459-172098481 GCAGGAGCCATGAGACGGGCAGG + Intronic
1002897492 6:1388207-1388229 GCAGGAGGCAGGAGAAAGGGAGG - Intergenic
1002923997 6:1594559-1594581 GCCCGAGGCAAGAGCCGCGCAGG - Intergenic
1004022854 6:11790329-11790351 GGAGGAGGCTAGAGCCACTCCGG - Intronic
1004632674 6:17436805-17436827 GCAGGAGGTGAGTGGCAGGCAGG + Intronic
1004742926 6:18480420-18480442 GCAGCAGGCAAGAGACAGCTTGG - Intergenic
1004881246 6:20010698-20010720 CCAGGAGCCAAGGGTCAGGCTGG - Intergenic
1005175797 6:23043099-23043121 GAGGGAGGCAGCAGCCAGGCTGG + Intergenic
1005405425 6:25482611-25482633 GCAGGAGGGCAGAGGCAGACAGG - Intronic
1005493246 6:26366665-26366687 GGTGGATGCAAGATCCAGGCAGG + Intronic
1006217485 6:32457392-32457414 CAAGGAGGCAACAGGCAGGCAGG - Intergenic
1006388644 6:33746252-33746274 GCAGGAGGCCGGCACCAGGCTGG - Intronic
1006418619 6:33919787-33919809 GCAGGTGGCACAGGCCAGGCTGG + Intergenic
1006435170 6:34022350-34022372 GGCGGAGGCAAGAGCCAGAAAGG + Exonic
1006510974 6:34520862-34520884 CCAGGAGCCAGGAGCCAGGAGGG - Intronic
1007163675 6:39812755-39812777 GGAGGAGGACAGAGGCAGGCAGG - Intronic
1007412315 6:41672134-41672156 GAAGTAGCCAACAGCCAGGCTGG + Intergenic
1007427918 6:41759257-41759279 GCAGGGGGAATGATCCAGGCAGG + Intergenic
1007444455 6:41894789-41894811 GAAGGAGGCAAAAGCCAGGGTGG - Intronic
1007734409 6:43971764-43971786 GCAGGAGACAGGAGCTGGGCAGG + Intergenic
1007734529 6:43972345-43972367 GCAGAGGGCAGGAACCAGGCTGG + Intergenic
1007834592 6:44664842-44664864 GCAGGAGGAAAGAGGGAGGGAGG + Intergenic
1007950588 6:45868676-45868698 GCAGAAGTGAAGAGTCAGGCAGG + Intergenic
1008045702 6:46849370-46849392 GCAGGATGGAAGACCCAGGATGG + Intergenic
1008681661 6:53878646-53878668 GCAGGAGGTGAGCGGCAGGCGGG - Intronic
1008959591 6:57252735-57252757 TAAGAAGGCAAGAGCAAGGCCGG - Intergenic
1009741707 6:67755658-67755680 GAAAGAGGAAAGAGCCAGGATGG - Intergenic
1010206763 6:73329441-73329463 GCAGGAGGCAACCGTCAGCCAGG - Intergenic
1011663758 6:89616217-89616239 GCAGGAGGCCTGGGGCAGGCAGG - Intronic
1013155365 6:107488359-107488381 CCAGGAGGCCAGAGCGAGCCAGG - Intergenic
1013582694 6:111551831-111551853 GAAGGTGGCAAAGGCCAGGCAGG + Intergenic
1013644948 6:112127768-112127790 GTTGGTGGCAAGGGCCAGGCTGG + Intronic
1013748077 6:113368925-113368947 GCAGGAGGGAGGGTCCAGGCTGG - Intergenic
1014983650 6:127976228-127976250 GCAGGAGGAAAGAGACATGTTGG - Intronic
1014994533 6:128125408-128125430 GCAGAAGGCAAAAGGGAGGCAGG - Intronic
1016688988 6:146913981-146914003 GGAGGAGGCAAGGGGCAGTCAGG + Intergenic
1016977671 6:149824944-149824966 TGGGGAGGCAAGAGGCAGGCTGG + Intronic
1017414689 6:154207155-154207177 GCAGAAGGCAGGAGAGAGGCTGG + Intronic
1017789107 6:157780124-157780146 GGTGGAGGAGAGAGCCAGGCAGG - Intronic
1017864996 6:158435464-158435486 GGAGGAGGCAAGATCCAGCTGGG - Intronic
1017949916 6:159127953-159127975 CCAGGCGGCAGGTGCCAGGCAGG - Intergenic
1018705446 6:166460655-166460677 GCAGCAGGGCAGGGCCAGGCTGG + Intronic
1018752812 6:166822065-166822087 GCAGGAGGCCAGCTCCAGGAGGG - Intronic
1018864616 6:167737095-167737117 GCAGAGGGCAAGGCCCAGGCAGG - Intergenic
1018872845 6:167796397-167796419 GCAGGAGGTCAGAGCCAGCCAGG - Intronic
1018901614 6:168054491-168054513 TCAGGTGGCATGAGGCAGGCCGG - Intergenic
1018919789 6:168163621-168163643 GCGGGAGGCAGGAGAGAGGCTGG + Intergenic
1019345901 7:530852-530874 CCTGGGGGCCAGAGCCAGGCAGG - Intergenic
1019351221 7:554916-554938 GCAGGAAGCAAGAGCAAGGCTGG - Intronic
1019809206 7:3152265-3152287 GCTGGAGGCAGGAGCCAGACAGG + Intronic
1020114246 7:5466757-5466779 GCAGGAGGCAGGAGGGAGGCAGG + Intronic
1020163862 7:5793434-5793456 GGAGGTGCCAAGAGCCAGCCAGG - Intergenic
1020263109 7:6542350-6542372 GTGGGAGGCAAGATCCTGGCAGG + Intronic
1020459265 7:8410254-8410276 GGAGGAGGCAAGAGTGAGCCAGG + Intergenic
1022132426 7:27416724-27416746 GCAGGTGGCAGGCGGCAGGCTGG - Intergenic
1022378352 7:29836051-29836073 GCAAGAGCCAAGTTCCAGGCAGG - Intronic
1022509361 7:30925395-30925417 GCAGCAGCCTAGAACCAGGCAGG - Exonic
1023057219 7:36300003-36300025 GCTCCAGGCAAAAGCCAGGCTGG - Exonic
1024247086 7:47478970-47478992 GGAGTGGGCAGGAGCCAGGCTGG + Intronic
1024294014 7:47828477-47828499 GCAGGAGGAAAGGGCAAGGTGGG + Intronic
1024772260 7:52736927-52736949 GCAGGAGGAAAGAGCCGGGCAGG + Intergenic
1025228478 7:57182945-57182967 GGAGGAGGAAACAGCCAGGCAGG - Intergenic
1025976738 7:66376579-66376601 GCGTGAGGCAGGAGCCGGGCTGG + Intronic
1025995232 7:66523540-66523562 TCAGGAGGGAGGGGCCAGGCCGG + Intergenic
1026735247 7:72945120-72945142 GCAGGCAGCCAGAGCCAGTCAGG + Intronic
1026785589 7:73300049-73300071 GCAGGCAGCCAGAGCCAGTCAGG + Intergenic
1026893737 7:73998285-73998307 GGTGGGGGCCAGAGCCAGGCAGG + Intergenic
1027108478 7:75419887-75419909 GCAGGCAGCCAGAGCCAGTCAGG - Intronic
1027219832 7:76206796-76206818 GCAGGAGGCTGAGGCCAGGCTGG - Intronic
1028419030 7:90611648-90611670 GCAGGAGGCAAGTCGTAGGCAGG - Intronic
1028860300 7:95641586-95641608 ACAGCAGTCAATAGCCAGGCAGG - Intergenic
1029272236 7:99384174-99384196 GGAGGAGGCTAGGGACAGGCTGG + Intronic
1029490486 7:100867679-100867701 GCAGGAGGAAGCAGCCAGGGCGG - Intronic
1030884543 7:114922155-114922177 TCAGGAGGCCAGAGCCGGCCTGG - Exonic
1030987965 7:116264377-116264399 GCTGGAGGCACGAGAAAGGCAGG - Intergenic
1031230779 7:119103056-119103078 GCAGCAGGCAATAGCCAAGAAGG - Intergenic
1032035058 7:128515449-128515471 GCAGGACAAAAGAGCCAGCCGGG + Intergenic
1032079201 7:128850182-128850204 GGAGCAGGCAAGAGTTAGGCTGG + Intronic
1032087888 7:128893247-128893269 GCTGGCGGCCAGAGGCAGGCAGG + Exonic
1032645950 7:133824267-133824289 GCAGGCGTTAAGGGCCAGGCAGG - Intronic
1032854442 7:135822680-135822702 GCTGGGGGAAAGAGCAAGGCCGG + Intergenic
1033736995 7:144232193-144232215 GTAGGAGACAAGCACCAGGCTGG + Exonic
1033746062 7:144318753-144318775 GTAGGAGACAAGCACCAGGCTGG - Exonic
1034852453 7:154507640-154507662 GCAGCAGGCAAGAGCAGGACTGG + Intronic
1035072796 7:156157350-156157372 GCAGAAGGGGAAAGCCAGGCAGG + Intergenic
1035672159 8:1426410-1426432 GCAGGAGCCCAGAGCTAGGGAGG + Intergenic
1036913906 8:12785942-12785964 GCAGCTGGCCAGAGCCAGGAGGG - Intergenic
1037337108 8:17801762-17801784 GCAGGTGGCCAGAGGCAAGCAGG - Intergenic
1037744199 8:21630197-21630219 GCAGGAGGCAGAAGCCAGCACGG + Intergenic
1037952504 8:23028202-23028224 GGAGGAGGATAGAGCCAGGCTGG + Intronic
1037963589 8:23117185-23117207 GGAGGAAGATAGAGCCAGGCTGG - Exonic
1037985792 8:23289895-23289917 GCAGGAGGCAGGAGCGCGGCAGG - Exonic
1037991347 8:23323397-23323419 GCAGGAGGCAGGAGACAGCGAGG - Intronic
1038332040 8:26616728-26616750 GCAGGAGGGAAGAGGGAGGATGG - Intronic
1039611290 8:38921371-38921393 GCAGCTGGCAACAGCCAGACAGG - Intronic
1039921935 8:41898963-41898985 GCAAGAGGACAGAGCCAGTCTGG - Intergenic
1041426060 8:57721919-57721941 GTAGGAGGAAAGAGCCTGGAAGG - Intergenic
1041756014 8:61313830-61313852 TCAGTAGGCAAGGGCTAGGCAGG - Intronic
1042338825 8:67657593-67657615 TCAGGAAGCAAGAGCTGGGCTGG - Intronic
1042387776 8:68197420-68197442 GCAGGAGGCAAAAGAGAAGCAGG - Intronic
1044229422 8:89757648-89757670 GGCCGAGGCGAGAGCCAGGCGGG + Intergenic
1044506207 8:93023021-93023043 GGGGCAGGCAAGAGTCAGGCAGG - Intergenic
1044785689 8:95789859-95789881 GCAGGAGGGAAGACCGTGGCTGG - Intergenic
1044850159 8:96419760-96419782 GCAGGAGGAGAAAGACAGGCAGG + Intergenic
1045550887 8:103171339-103171361 GAAGGAGGAAAGAGCAAGGAAGG + Intronic
1047041997 8:121006816-121006838 GCAGGTGGTAGGAGCCAGGCTGG + Intergenic
1047361234 8:124171521-124171543 GCAGCAGGCAAGAGCGAGCTGGG + Intergenic
1047381934 8:124372306-124372328 ACAGGAGGCGAGAGCCGCGCGGG - Exonic
1047642383 8:126834248-126834270 GCAGGAAGCGTGAGCAAGGCTGG + Intergenic
1047714842 8:127586101-127586123 GCAGGAGGCAAGAGGGAGGCAGG - Intergenic
1047764986 8:127983115-127983137 ACAGGAGGCCAGAGGGAGGCAGG - Intergenic
1047900438 8:129415632-129415654 GCAGGAGGCAAGAGGAACGGAGG + Intergenic
1048845647 8:138601991-138602013 ACAGGCGGCATGATCCAGGCGGG + Intronic
1049240449 8:141535166-141535188 GCAGGAAGGAAGAGCCAGGAGGG + Intergenic
1049299588 8:141862499-141862521 ACAGGAGGCAAAGGCCAGACAGG - Intergenic
1049351505 8:142167166-142167188 GCAGGAGGCAAGAGAGAGGCCGG + Intergenic
1049434028 8:142577983-142578005 GCAGGAGGCCACAGGCTGGCAGG - Intergenic
1049511377 8:143028399-143028421 TCAGGAGGTAAGGCCCAGGCAGG + Intergenic
1049775365 8:144401462-144401484 GCAGCTGGCAGGAGCCAAGCGGG - Exonic
1050084567 9:1951107-1951129 GGAGGAGGCAACATCTAGGCTGG + Intergenic
1050519673 9:6484424-6484446 GGAGGAGGGAAGAGACAGGAGGG - Intronic
1050615394 9:7396590-7396612 ACTGGAGGCAAGAGCCACACTGG - Intergenic
1053274272 9:36771393-36771415 TCAGGAGGGCAGGGCCAGGCTGG - Intergenic
1053651871 9:40177336-40177358 GCAGGATGGAAGAACCAGGATGG - Intergenic
1053902261 9:42806649-42806671 GCAGGATGGAAGAACCAGGATGG - Intergenic
1053946112 9:43311598-43311620 GCAGGAGCCAAAAGCCACGGTGG - Intergenic
1054532714 9:66198871-66198893 GCAGGATGGAAGAACCAGGATGG + Intergenic
1054752490 9:68922063-68922085 GCAGAAGGCAAGAGCCTGAGGGG - Intronic
1055989925 9:82094516-82094538 GAAGCAGGGAAGAGCCAGGCTGG + Intergenic
1056193463 9:84206880-84206902 TCAGGAGGCAAGTCTCAGGCTGG + Intergenic
1056262715 9:84864635-84864657 GCAGGAGGGAACAGCCATGCCGG + Intronic
1056762354 9:89424642-89424664 CCAGGAGACCAAAGCCAGGCAGG - Intronic
1056943596 9:90975611-90975633 GCGGGGGCCATGAGCCAGGCGGG - Intergenic
1057192174 9:93094397-93094419 CCTGGAGGCCAGAGCCAGCCTGG + Intergenic
1057228661 9:93305685-93305707 GCAGGAGGCATGAGCCCTTCTGG + Intronic
1057646215 9:96877449-96877471 CCAGGAGGCTGGAGCCACGCGGG - Intergenic
1058459098 9:105166285-105166307 GCAAGAGGATAGAGCCAGCCAGG + Intergenic
1058588515 9:106535699-106535721 GCAGAAGGCAGGAGGCAGGAAGG + Intergenic
1059415765 9:114161684-114161706 GCACGTGGCCAGAGACAGGCGGG - Intronic
1059527116 9:115002397-115002419 GCAGGAGGAAAGAGAGAGGATGG + Intergenic
1059801091 9:117750223-117750245 GCAGGAGGCATAAGGAAGGCAGG + Intergenic
1060815035 9:126630783-126630805 GCAGGAGGGCAGACCCTGGCCGG - Intronic
1060826272 9:126689773-126689795 GCTGGAGGCAACTCCCAGGCTGG - Intronic
1061218988 9:129237994-129238016 CCAGGAGGGAAGAGCCTGCCTGG + Intergenic
1061381894 9:130263891-130263913 ACAGGAGCCAGGAACCAGGCAGG - Intergenic
1061781701 9:132999976-132999998 GATGGAGACAAGTGCCAGGCTGG - Intergenic
1061913469 9:133737364-133737386 TCTGCAGGCAGGAGCCAGGCGGG - Intronic
1062209977 9:135358295-135358317 GCAGGAGGACCCAGCCAGGCCGG + Intergenic
1062215848 9:135389415-135389437 GCAGGAAGGTAGAGCCAGCCAGG - Intergenic
1062351518 9:136141984-136142006 CCAGGAGGCCAGAGCTGGGCAGG - Intergenic
1062695953 9:137876659-137876681 GCATGAGGCAACAGGCAGGAAGG + Intergenic
1203423818 Un_GL000195v1:19308-19330 CCTGTAGGCAAGACCCAGGCAGG + Intergenic
1203589240 Un_KI270747v1:40156-40178 GCAGGAGCCAAAAGCCACGGTGG - Intergenic
1187023824 X:15411767-15411789 GCGGGAGGGAAGAACCAGGCAGG - Intronic
1187365877 X:18665480-18665502 GACGGAGGCAAGAGACAGTCTGG - Intronic
1189163330 X:38833556-38833578 CCAGGAGGCAAGAACCAGTGGGG - Intergenic
1190050865 X:47147364-47147386 GCAGGAAGCATCACCCAGGCTGG + Exonic
1190794091 X:53725246-53725268 GCAGAATGCAAGAGCCACGGAGG + Intergenic
1192170735 X:68852950-68852972 GCCCAAGGCAAGAGCCAGGTAGG - Intergenic
1192557256 X:72100558-72100580 GCAGGAGGTGAGTGGCAGGCGGG + Intergenic
1192587380 X:72329655-72329677 GCAGGAGGCAGCTGACAGGCAGG - Exonic
1193015345 X:76726027-76726049 GCAGGAGGGAGGAGCCAAGATGG - Intergenic
1195938526 X:110147461-110147483 GCTGTAGGCAAGAGACAGGAAGG - Intronic
1197421256 X:126238443-126238465 GTAGGTGGCAGGAGGCAGGCAGG + Intergenic
1199708236 X:150449688-150449710 GCAGGAGGCCAGAGATAGACAGG - Intronic
1199769623 X:150966292-150966314 GGGCGAGGGAAGAGCCAGGCGGG + Intergenic
1200001887 X:153066402-153066424 GCAGGAGGCAGGTGCTAGCCTGG + Intergenic
1200005846 X:153083623-153083645 GCAGGAGGCAGGTGCTAGCCTGG - Intergenic
1201329825 Y:12805566-12805588 GCAGCCTGCAAGAGCCAGGATGG - Intronic