ID: 923008994

View in Genome Browser
Species Human (GRCh38)
Location 1:230073460-230073482
Sequence TGCTGCAGGAGGCAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923008994_923008999 -7 Left 923008994 1:230073460-230073482 CCTGGCTCTTGCCTCCTGCAGCA 0: 1
1: 0
2: 2
3: 39
4: 426
Right 923008999 1:230073476-230073498 TGCAGCACAGGGTGAAACACTGG 0: 1
1: 0
2: 1
3: 17
4: 225
923008994_923009000 26 Left 923008994 1:230073460-230073482 CCTGGCTCTTGCCTCCTGCAGCA 0: 1
1: 0
2: 2
3: 39
4: 426
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54
923008994_923009001 27 Left 923008994 1:230073460-230073482 CCTGGCTCTTGCCTCCTGCAGCA 0: 1
1: 0
2: 2
3: 39
4: 426
Right 923009001 1:230073510-230073532 TTAGTCATGTCTACTAGTATGGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923008994 Original CRISPR TGCTGCAGGAGGCAAGAGCC AGG (reversed) Intronic
900703425 1:4061741-4061763 AGCGGCAGGTGGCAAGAGGCCGG - Intergenic
900807272 1:4775772-4775794 TGCTGCAGCAGGTAAGAGGCGGG + Intronic
901176085 1:7300295-7300317 TGCTGCACCAGGAATGAGCCTGG - Intronic
901188543 1:7390078-7390100 GGGTGCAGGAGCCAAGAGCCCGG + Intronic
901861857 1:12079561-12079583 TGGAGAAGGAGGCAAGGGCCGGG - Intronic
902760695 1:18578985-18579007 TGAAGCAGGAGGCATGAACCTGG + Intergenic
902773828 1:18661706-18661728 GGCTGCAGCACACAAGAGCCTGG + Intronic
903188962 1:21645817-21645839 TGCTGCAGGAAGCACAAGGCTGG - Intronic
903623352 1:24714028-24714050 CGTGGCAGGAGGCAAAAGCCTGG - Intergenic
903810115 1:26030621-26030643 TGAAGCAGGAGTCAAGAGCCAGG - Intronic
904775322 1:32902515-32902537 TGGTGGAGTAGGCAGGAGCCTGG + Intergenic
905242124 1:36588185-36588207 TGCTGAGGGAGGGAGGAGCCAGG + Intergenic
905393515 1:37652968-37652990 AGGGGCAGGGGGCAAGAGCCTGG - Intergenic
905514459 1:38551895-38551917 TGCAGGAGGAGGGAACAGCCAGG + Intergenic
906659288 1:47571252-47571274 GGATGCTGGAGCCAAGAGCCTGG - Intergenic
906929271 1:50153028-50153050 TGCTGCAGGACCAACGAGCCAGG + Intronic
907017577 1:51032275-51032297 TGCAGCAGGAGACAAGTGGCAGG - Intergenic
907051671 1:51333765-51333787 TGCTTCTGGAGGCTAGGGCCTGG + Intronic
907966873 1:59340207-59340229 TGTTGCAGAAGTCAAGAGCTTGG + Intronic
908678437 1:66632252-66632274 TGCTGCAGTGGTCAAGAGCAAGG - Intronic
909182960 1:72449056-72449078 TTCGGGAGGAGGCAAGTGCCAGG - Intergenic
909283311 1:73785035-73785057 TGCTCCAGGGGAGAAGAGCCTGG - Intergenic
909941269 1:81614636-81614658 TTCTGCAGGAAGTCAGAGCCAGG + Intronic
910351441 1:86303413-86303435 TGCTGCAGCTGGAAAGAGCTGGG + Intergenic
910832326 1:91473493-91473515 TCCTGCAGGTGGCAAGACCCTGG + Intergenic
912516870 1:110221819-110221841 GGCAGCAGGAGGCATGAGACTGG + Intronic
912648735 1:111419580-111419602 TGCTGGAGCATGAAAGAGCCAGG + Intronic
913376361 1:118156946-118156968 TGCTGCAGGAGGCAGATGTCAGG - Intronic
915970798 1:160353714-160353736 TGCTACAGGAGTCCAGAGCAGGG - Intronic
916435694 1:164775829-164775851 TGCAGCAGGTGACAAGGGCCAGG - Intronic
917287741 1:173439458-173439480 TGCTGCAGGTGGGCAGAGGCTGG - Intergenic
917502719 1:175599895-175599917 TGCTGAGGCAGGCAAGAGACTGG + Intronic
919632708 1:199974551-199974573 TCCTGAAAGAGGGAAGAGCCAGG + Intergenic
920529293 1:206690277-206690299 TGCTGCAGGAGCCAGGGGTCAGG - Intronic
923008994 1:230073460-230073482 TGCTGCAGGAGGCAAGAGCCAGG - Intronic
923024539 1:230194390-230194412 TCCTGCAGGGGTCCAGAGCCAGG + Intronic
923112990 1:230907923-230907945 TGCTTCTGGAAACAAGAGCCAGG + Intronic
923540501 1:234885055-234885077 GGGTGCAGGAGGGAAGAGCCAGG - Intergenic
923687170 1:236161331-236161353 TGCTGCAGGAGCCCGGAGCTGGG - Intronic
1063246834 10:4229215-4229237 TCCTCCAGGAGACAAGAGCTAGG + Intergenic
1063558427 10:7102997-7103019 TGCTGCAAGATGCAAAAGCCTGG - Intergenic
1063683126 10:8209532-8209554 AGCTGCTTGAGGCAAGGGCCAGG + Intergenic
1064718070 10:18197497-18197519 GGCTGAAGGAGGACAGAGCCAGG - Intronic
1067563354 10:47319656-47319678 TTCTGCAGGAGGGAACATCCAGG + Intergenic
1067735019 10:48844060-48844082 TGCAGCAGGCGGCAGGCGCCAGG - Intronic
1071157453 10:82707484-82707506 TGCCTCAGGAGGCAAGAAGCTGG + Intronic
1071730860 10:88247143-88247165 AGCTGGAGGAGGGCAGAGCCTGG + Intergenic
1071891984 10:90019224-90019246 TCCTGAAGGAGGTAAGACCCTGG - Intergenic
1071948054 10:90670722-90670744 TGCTGCAGGATGGAGGAGCCAGG + Intergenic
1072189121 10:93066311-93066333 GGCGGCAGGAGGCAGGAGGCTGG - Intronic
1072619140 10:97068236-97068258 TGCAGCTGGAGGGAGGAGCCTGG + Intronic
1073072825 10:100805687-100805709 TCCTGTAGGAGGCTTGAGCCTGG + Intronic
1073134869 10:101214974-101214996 GGCTGCAGGAAGAAAGAGCCTGG + Intergenic
1074080891 10:110167191-110167213 TGCTAGAGGAGGGAAGACCCAGG - Intergenic
1074614762 10:115056527-115056549 TGTTACAGAAGGCAAGAGTCAGG - Intergenic
1074910665 10:117905705-117905727 GGCTGAAGGAGGCCAGGGCCAGG - Intergenic
1076184371 10:128434834-128434856 TGCTGCAGGACACAAAAGCCTGG - Intergenic
1076785658 10:132748676-132748698 TGCTCCAGGAGGCACGGTCCTGG - Intronic
1077698590 11:4418537-4418559 TGCTGCAGGAGGATAGGTCCCGG - Intergenic
1079256434 11:18835109-18835131 GGCTGCTGGAGGCCAGAGGCTGG - Intergenic
1079312604 11:19379625-19379647 TGCCGGAGGAGGGAAGAGTCAGG - Intronic
1079881048 11:25927082-25927104 AGATTCAGGAGGAAAGAGCCAGG + Intergenic
1080590799 11:33721708-33721730 TGGAGCAGGAGGGAAGAGCAGGG + Intronic
1081999189 11:47383678-47383700 TGCTGCAGGAGGGAGAAGCTGGG - Intergenic
1082783245 11:57302678-57302700 TGTTGGAGGAGGAAGGAGCCGGG - Exonic
1083651811 11:64208549-64208571 TGCTCCAGGAGGCCAGGGACTGG - Intronic
1084057587 11:66646320-66646342 AGCCGCAGGAGGCAGGAGGCAGG - Exonic
1084486408 11:69450702-69450724 AGCCGCAGGAAGCAACAGCCAGG - Intergenic
1084948659 11:72652776-72652798 TGCTGCAAGAGGCACAAGCTTGG - Intronic
1085044833 11:73346753-73346775 GGCGGCAGGAGGGAAGGGCCAGG + Intronic
1085324464 11:75595873-75595895 TACGGAAGGAGGCAAGAGGCAGG - Intronic
1085411362 11:76292548-76292570 TGCAGCATAAGGCAAGAGGCTGG - Intergenic
1088360706 11:108986038-108986060 GGCTGCAGGAGGAAAGTGCCCGG - Intergenic
1088558147 11:111083785-111083807 TTGTGCAGGGGGCAGGAGCCTGG - Intergenic
1089161701 11:116443059-116443081 TGCTGCAGGAGGCAGAATCTTGG - Intergenic
1089298386 11:117483125-117483147 AGCAGCAGGAGGCAAGGGGCAGG + Intronic
1090198817 11:124839559-124839581 TGATGGAGGAGGCGGGAGCCCGG + Intergenic
1091037487 11:132246856-132246878 GCCTACAGCAGGCAAGAGCCCGG + Intronic
1091219097 11:133920033-133920055 TGCTGCAGGAGGCCCGGGCGAGG + Exonic
1091287743 11:134417483-134417505 TTCTGCAGGGGAGAAGAGCCGGG + Intergenic
1091588010 12:1827138-1827160 TGCTGCAGCTGGCAAGGGCGGGG - Intronic
1092284083 12:7118953-7118975 TCCTGCAGGAGACCAGGGCCAGG + Intergenic
1094042859 12:26135477-26135499 AGATGCAGGAGGCAGGAACCAGG + Intronic
1095836427 12:46644411-46644433 TACTGCAGGAGGCTTGAGGCAGG - Intergenic
1096745227 12:53722417-53722439 TGCTGGATGAGGAAAGGGCCAGG - Intronic
1097698920 12:62801024-62801046 TGCTGGAGGAGAACAGAGCCAGG - Intronic
1097893410 12:64800722-64800744 TGCTGTGGGAGGCTAGAGGCAGG + Intronic
1098206790 12:68119063-68119085 TTCTCCAGCAGGCAAGAGGCAGG - Intergenic
1099018891 12:77379098-77379120 TGCTGCAATAGGTAAAAGCCTGG - Intergenic
1099067300 12:77998361-77998383 TGCTGCAGGAAGCAGCAGCAAGG + Exonic
1099884881 12:88516437-88516459 TTCTTCAGGAGTAAAGAGCCTGG + Exonic
1100158294 12:91827861-91827883 TGCTTCATGATGCAAAAGCCAGG + Intergenic
1100209338 12:92385445-92385467 TCCTGCAGGGGCCAAGTGCCTGG - Intergenic
1100608425 12:96170619-96170641 GGCTGCAGGAGGAAAGAGGCTGG + Intergenic
1101348092 12:103904841-103904863 TGTTGGAGGAAGCAAGTGCCAGG - Intergenic
1102002443 12:109565904-109565926 TGGTGCAGGAGGGAAGTGCAGGG - Intronic
1102219863 12:111187274-111187296 TGCTACAGGAGTCACGAGCAAGG - Intronic
1102392915 12:112563896-112563918 TGTTGAAGGAGGCAGCAGCCAGG - Intergenic
1102806092 12:115782271-115782293 TGCTGCAGGAAGACAGAGACTGG + Intergenic
1103212770 12:119178875-119178897 TGCTGCTGGAGGCTGGAGGCGGG - Exonic
1104245444 12:127035661-127035683 AGCTGCAGGCGGCACCAGCCAGG + Intergenic
1104706566 12:130951816-130951838 TGCTGCGGGAGGGCAGAGCCAGG + Intergenic
1104727055 12:131084653-131084675 TCCCGCTGGAGGTAAGAGCCAGG + Exonic
1104857683 12:131909611-131909633 TGCTGCTGGAGGTATGAGCATGG - Intronic
1104909799 12:132235264-132235286 TGCTGGAGGAGTGAGGAGCCGGG + Intronic
1105211726 13:18261086-18261108 TGCAGGTGTAGGCAAGAGCCAGG - Intergenic
1105462716 13:20607185-20607207 CGGTGCAGGGGGCAAGCGCCAGG - Intronic
1105558052 13:21464617-21464639 TGCTGCAGGAAGCAAGACCCAGG - Intergenic
1105746671 13:23383579-23383601 TGCTGCAGGAGGAAACAGAATGG - Intronic
1107327917 13:39264816-39264838 TGCTGCTCTAGGCAACAGCCAGG - Intergenic
1107596955 13:41973269-41973291 TGCCACAGGAGGCAGGAGCAGGG - Intergenic
1107991275 13:45820814-45820836 CGCAGCAGGAAGCAAGTGCCAGG - Intronic
1108454561 13:50599782-50599804 TGCTGCAGGAGACAAGTAACAGG - Intronic
1109500816 13:63234749-63234771 GGATGCAGGAGGCAAGGGTCAGG - Intergenic
1111469308 13:88657037-88657059 TGCTGCAGGATGAAAGAGTGAGG - Intergenic
1111556749 13:89890815-89890837 TGCAGCAACATGCAAGAGCCTGG + Intergenic
1111736083 13:92141016-92141038 TGTTGGAGGAGGCAAGAGAGAGG + Intronic
1111857988 13:93663925-93663947 AGCTAGAGGAGGCAAGAGCATGG + Intronic
1112416197 13:99205362-99205384 TGCTGTAGGAGGGAAGAGGAGGG + Intronic
1113537205 13:111077102-111077124 TCATGGAGGAGGCAAGTGCCGGG + Intergenic
1114647894 14:24265719-24265741 TGGGGCAGGAGGCAAGAGGCTGG + Exonic
1114971181 14:28030615-28030637 TGCTTCAAGAGGCAAAAACCAGG + Intergenic
1117668305 14:58080024-58080046 ATCTGCAGTAGGCAACAGCCAGG + Intronic
1118249985 14:64150243-64150265 TGCTGCAGTAGGCATGATCTCGG - Intronic
1120803254 14:88716990-88717012 AGCAGAAGGAGGCAAAAGCCTGG + Intronic
1121005885 14:90490459-90490481 TGCTGCAGGATACAGAAGCCAGG + Intergenic
1121449128 14:93996575-93996597 GGGTGAAGGAGGCAGGAGCCAGG - Intergenic
1121640430 14:95481545-95481567 TGCTGCAGGAGACACCACCCAGG + Intergenic
1121736134 14:96219430-96219452 AGCAGCAGGAGCCAAGTGCCAGG - Intronic
1122237962 14:100343343-100343365 TGCTGAAGGAGGGAGCAGCCTGG + Exonic
1123505709 15:20940504-20940526 TGCTGCCGCAGGCTGGAGCCTGG + Intergenic
1123562943 15:21514210-21514232 TGCTGCCGCAGGCTGGAGCCTGG + Intergenic
1123599190 15:21951493-21951515 TGCTGCCGCAGGCTGGAGCCTGG + Intergenic
1124410533 15:29432870-29432892 TGAGGCTGGAGGCAGGAGCCAGG - Intronic
1124414568 15:29464557-29464579 TACTTCAGGAAGCAAGTGCCAGG + Intronic
1125758791 15:42083507-42083529 TGTTGCAGAAGGCAGGAGTCCGG - Intronic
1128159357 15:65413347-65413369 CCATGCAGGAGGCCAGAGCCAGG + Intronic
1128346321 15:66854710-66854732 CGTTCCAGGAGGCAGGAGCCTGG + Intergenic
1128439131 15:67687500-67687522 TGCTCCTGGAGGCCAGAGACAGG + Intronic
1128958158 15:71971839-71971861 GGCTGCAGGAGTTATGAGCCAGG - Intronic
1128998182 15:72312184-72312206 GGCTGCAGGAGGTGGGAGCCAGG + Intronic
1129160517 15:73745126-73745148 TGCAGCATGAAGCAAGAGCTGGG - Intronic
1129207895 15:74048106-74048128 AGCTGCTGGAGCTAAGAGCCAGG - Intergenic
1131007131 15:88987364-88987386 TGGTTTAGGAGGCAAGAGGCTGG - Intergenic
1202971295 15_KI270727v1_random:241345-241367 TGCTGCCGCAGGCTGGAGCCTGG + Intergenic
1132469339 16:93191-93213 TGCTGCTGGCTGCCAGAGCCTGG - Intronic
1132568955 16:635773-635795 TGCTGCAGGAGGCGAACGCTTGG + Exonic
1133397367 16:5458950-5458972 TGATGGAGGAGAAAAGAGCCTGG - Intergenic
1135015665 16:18922982-18923004 TGAGGCAGGAGGCTTGAGCCTGG + Intronic
1135321285 16:21498789-21498811 TGAGGCAGGAGGCTTGAGCCTGG + Intergenic
1135374118 16:21930291-21930313 TGAGGCAGGAGGCTTGAGCCTGG + Intergenic
1135437668 16:22440430-22440452 TGAGGCAGGAGGCTTGAGCCTGG - Intergenic
1135724549 16:24844644-24844666 TCCTGCAGGACTCTAGAGCCAGG + Intergenic
1135788105 16:25368435-25368457 TTATGCAGGAGGGAGGAGCCTGG + Intergenic
1135937860 16:26796349-26796371 TTCTGCAGCAGGAAAGAGTCTGG + Intergenic
1136332762 16:29591912-29591934 TGAGGCAGGAGGCTTGAGCCTGG + Intergenic
1136447456 16:30332000-30332022 TGAGGCAGGAGGCTTGAGCCTGG + Intergenic
1136526454 16:30834474-30834496 TGCTGCAGAAGGCGGGAGGCCGG + Exonic
1138415191 16:56867612-56867634 TGCTCCGGGAGGCAGGAGGCTGG + Intronic
1138497525 16:57417196-57417218 AGCAGCAGGAGGCAACAGCCGGG - Intergenic
1138594929 16:58024883-58024905 GGATGCAGGAGGCCAGAGCTGGG - Intergenic
1138738561 16:59280578-59280600 TGCTGCTGGAGGCAGCAGCAGGG - Intergenic
1139583782 16:67888228-67888250 TGCTACAGTAAGCAAGAGCTTGG + Intronic
1139631734 16:68235622-68235644 TGCTGCAGCAGGTGAGCGCCGGG - Exonic
1141261711 16:82460243-82460265 TGCAGCAGGAGGGAACAGCAAGG - Intergenic
1141638925 16:85329912-85329934 GGATGCAGGGGGCAAGAGGCTGG + Intergenic
1141655864 16:85416283-85416305 TGCTGGAGGAGGGAGGGGCCCGG + Intergenic
1141831601 16:86512380-86512402 AGCCCCAGGAGGCAGGAGCCAGG + Intronic
1141883578 16:86876046-86876068 TGCTGCAACAGGGATGAGCCCGG + Intergenic
1142076353 16:88120302-88120324 TGCAGCAGAAGGCAGGGGCCTGG - Intergenic
1142115792 16:88355503-88355525 TGCTGCAGGGTGCGGGAGCCCGG - Intergenic
1142517684 17:443406-443428 GGCTGCAGGAGGCCACCGCCAGG + Exonic
1142681841 17:1554487-1554509 TGAGGCAGGAGGCAGGAGGCAGG - Intronic
1142689844 17:1598879-1598901 TGTTCCAGGCGGCAAGAGGCAGG - Intronic
1143185049 17:5004929-5004951 AGCTGCAGGAGGAAGTAGCCCGG + Exonic
1143217908 17:5238922-5238944 TGCTGGCAGAGGCAAGAGACTGG + Intergenic
1143381327 17:6498107-6498129 TGCAGCAGGAGGGGTGAGCCGGG + Intronic
1143801077 17:9381491-9381513 TGCTGCAGGAGGCAAGAAGCAGG - Intronic
1144541665 17:16148180-16148202 TGCTGAGGGAAGCCAGAGCCAGG - Intronic
1144631967 17:16878281-16878303 TGGTGCAGGAGGGAACATCCAGG - Intergenic
1145252695 17:21305030-21305052 GGCTGCAGGAGGGAAGAGTGAGG - Exonic
1146319586 17:31836336-31836358 TGATGCAGGAGAAAAGAGGCAGG + Intergenic
1146473285 17:33141262-33141284 GGCTGCAGGAGCCTAGAGGCTGG - Intronic
1147317552 17:39627988-39628010 GACAGCAGGAGGCCAGAGCCAGG - Intronic
1147324196 17:39662615-39662637 TGTTGCTGGTGCCAAGAGCCAGG + Intronic
1147366856 17:39964729-39964751 TGCTGCTGGCAACAAGAGCCTGG - Intronic
1147698024 17:42371286-42371308 TGCAGCAGGATGCAGGAGCTGGG + Intronic
1148106711 17:45122739-45122761 TGTTCCAGGGGGCCAGAGCCAGG - Intronic
1148129695 17:45255419-45255441 TGCTGGAGGAGGCCATGGCCAGG + Exonic
1148355380 17:46972184-46972206 TGGGGCAGGAGGCGAGACCCTGG + Intronic
1148485356 17:47987418-47987440 TGCTGCAGGCGTGTAGAGCCCGG + Intergenic
1148904007 17:50900109-50900131 TTCTGCAGGAGGCAAGCTGCAGG + Intergenic
1149329569 17:55567310-55567332 AGAGGGAGGAGGCAAGAGCCTGG + Intergenic
1149503679 17:57175098-57175120 GGCAGGAGGAGGCAGGAGCCAGG + Intergenic
1149969397 17:61201573-61201595 TGCTGGAGGAGGTGAGAGACTGG + Intronic
1152685084 17:81689974-81689996 TGTGGCGGGAGACAAGAGCCAGG - Intronic
1152730923 17:81969516-81969538 GGCTGCAGGAAGCCTGAGCCAGG - Intergenic
1154377123 18:13819803-13819825 TGCTGCAGCTGCCAAGAGCTGGG + Intergenic
1154945575 18:21158394-21158416 TGGTGGAGGAGGCAAGTGCCAGG + Intergenic
1155509168 18:26559871-26559893 TGCTGCAGGACGCAATGGCCAGG + Intronic
1155523765 18:26695817-26695839 TGAGGCAGGAGGCTTGAGCCTGG + Intergenic
1155585584 18:27360339-27360361 TTCTGCCAGAGGCAACAGCCTGG + Intergenic
1156623950 18:38886169-38886191 TGGTGCAGGACGGAAGGGCCAGG - Intergenic
1157179773 18:45486721-45486743 TGCTGCAGGAAGCAACAGAATGG - Intronic
1157565297 18:48675575-48675597 TGCTGCAGGGAGGAAGGGCCTGG - Intronic
1158266722 18:55667052-55667074 TGCTGCAGGCTGCAGGAGCCGGG + Intergenic
1158404701 18:57151000-57151022 AGCAGCAGCAGGCAAGAGCTCGG + Intergenic
1158892914 18:61889757-61889779 TGCTGCAGGAGGCCACCTCCTGG + Intronic
1159107444 18:64019265-64019287 GGATGCAGGAGGCAAGAGTAAGG - Intergenic
1159844028 18:73437222-73437244 TGCTGCAGAAGACAAGAGGGAGG + Intergenic
1160309220 18:77773143-77773165 AGCTGCAGAGGGCATGAGCCTGG - Intergenic
1160471053 18:79134087-79134109 TGGAGCAGGTGGCCAGAGCCAGG - Intronic
1160739215 19:678146-678168 AGCTGCAAGAGGCTGGAGCCTGG - Intronic
1160837346 19:1131171-1131193 TGGTGAAGGATGCAGGAGCCTGG - Intronic
1161195563 19:2984315-2984337 TGCCCCAGGAGGCATCAGCCTGG + Intronic
1161206937 19:3046480-3046502 CTCTGCTGGAGGCCAGAGCCTGG + Intronic
1161299877 19:3537517-3537539 AGGTGCAGGAGGCAGGAGCCTGG + Intronic
1161506754 19:4648339-4648361 TCCTGCAGGAAGGAAGACCCAGG + Intronic
1161698999 19:5784889-5784911 TGCTGGAAGAGGCAAAGGCCTGG - Intronic
1161703150 19:5805554-5805576 TGCTGCAGGAGGGAATCCCCTGG - Intergenic
1161792785 19:6370654-6370676 TGCTGTGGGAGCCAAAAGCCAGG + Intergenic
1162356901 19:10191662-10191684 TGCTGCAGGAGTTAACTGCCAGG - Intronic
1162600311 19:11663841-11663863 TCCTGTAGGAGGTGAGAGCCTGG + Intergenic
1163104919 19:15117796-15117818 TGCTGCAGCTGGCTTGAGCCTGG - Intronic
1163636957 19:18441444-18441466 TGGTGCAGGTGGAACGAGCCAGG - Intergenic
1164403709 19:27922585-27922607 TGTTGCAGGAGGCTAGAGGGTGG + Intergenic
1165468629 19:35990098-35990120 TACTGCAGCAGCCAGGAGCCTGG + Intergenic
1165493003 19:36136012-36136034 TGATGCAGGATGTAGGAGCCTGG + Intergenic
1166571173 19:43798151-43798173 TGAGGGAGGAGGCAAGACCCTGG - Intronic
1168073828 19:53967998-53968020 TGATGTAGGAGGCCAGAGGCTGG + Intronic
1168183170 19:54677468-54677490 GGCTGGAGGAGGCAAGTGTCTGG - Intronic
1168352717 19:55685854-55685876 TGGGGCACGAGGCAAGAGGCAGG - Intronic
1168527260 19:57099159-57099181 TGCTGCAGCAGCCGAGAGCCCGG - Intergenic
925065567 2:927039-927061 TGCTTCAGAAGGAAAGAACCAGG - Intergenic
925124557 2:1444870-1444892 TGCTGCAGGAGGCACCATGCTGG + Intronic
925124653 2:1445468-1445490 TGCTGCAGGAGGCACCATGCTGG + Intronic
925139915 2:1543054-1543076 GGCTGCTGGAGGCAGAAGCCTGG - Intronic
925218096 2:2114738-2114760 TGCTACAGGTGGCCAGACCCAGG + Intronic
925452180 2:3979024-3979046 TTCTGCGGGAGGCAGGAGGCGGG + Intergenic
926380388 2:12281113-12281135 TGAAGAAGGAGGCAGGAGCCAGG + Intergenic
927422571 2:22948655-22948677 CGCTGCATGAAGCAAGAGCCAGG + Intergenic
927490295 2:23516845-23516867 TGAGGCAGGAGGCAGGAGGCAGG + Intronic
927510274 2:23639999-23640021 TGCTGAAGGAAGCATGTGCCGGG - Intronic
927580333 2:24238091-24238113 TGCTGGAGGAAGCAACTGCCAGG - Intronic
927789306 2:25997937-25997959 CATTTCAGGAGGCAAGAGCCTGG - Intergenic
928324548 2:30309221-30309243 TCCTGCAGGAGCCAAGTGGCTGG + Intronic
928669226 2:33583817-33583839 TGCTGCAGAAAACAAAAGCCTGG - Exonic
929090641 2:38213947-38213969 TGCTGCAGGGAGCAGGTGCCAGG + Intergenic
929115724 2:38442279-38442301 ATTTGCAGGAGGGAAGAGCCAGG + Intergenic
929601617 2:43208079-43208101 GGCTGCAGGAGGGCAGGGCCAGG + Intergenic
931721625 2:65071304-65071326 TGCTGCCTGAGGCAAGAACCAGG - Intronic
934301899 2:91781369-91781391 TGCAGGTGTAGGCAAGAGCCAGG + Intergenic
934922926 2:98360128-98360150 TGCTGCTGAAGGCCGGAGCCAGG - Intronic
936483263 2:112905401-112905423 GGCTGCAGGAGGCAGGAGGCAGG + Intergenic
938179868 2:129170728-129170750 TGCTGAAGTGGGCAAGTGCCTGG + Intergenic
938313442 2:130310065-130310087 TCCTGAAGGAGGCAGGATCCTGG - Intergenic
938408526 2:131045827-131045849 TGCTGCAGGAGGCCAGGCCCAGG + Intronic
939511597 2:143112942-143112964 TCCTCCAGGAGGGAAGAGCTTGG + Intronic
942146321 2:173030682-173030704 TGCTTCTGGAAGGAAGAGCCAGG + Intronic
942895393 2:181047331-181047353 TCCTGCAGGTGGGATGAGCCAGG - Intronic
943700320 2:190981976-190981998 TGCTGCAGTGGGCAAGCCCCAGG + Intronic
944689822 2:202149043-202149065 TCCTGCAGGAGCAAAGGGCCTGG - Intronic
944926954 2:204475137-204475159 TGCAGAAGGAGGCAAGTGGCTGG - Intergenic
945862557 2:215140353-215140375 TGATGAAGCTGGCAAGAGCCAGG - Intergenic
946181948 2:217954175-217954197 TGTGGAAGGAGGCAGGAGCCAGG + Intronic
946237145 2:218331000-218331022 TGTTGCTGGAGGCAAGAAGCAGG - Intronic
947257498 2:228181852-228181874 GCCTGCAGGAGGCAGGAGCCAGG - Intergenic
947260562 2:228217482-228217504 TGCTGAAACTGGCAAGAGCCTGG - Intergenic
948756071 2:240160385-240160407 TGCAGCAGGTGGCCAGAGCCTGG - Intergenic
948814732 2:240504071-240504093 TGCTGCAGCAGACCATAGCCTGG - Intronic
1168778723 20:470564-470586 TGCTGCAGGAGTCAAATACCTGG + Intergenic
1168976462 20:1969720-1969742 GACTGCAGGAGGTGAGAGCCGGG - Intergenic
1169220317 20:3818823-3818845 AGCTGCAGGTGGCCAGGGCCTGG - Intergenic
1169832450 20:9839122-9839144 GGGTGCAGGAGCCAGGAGCCGGG + Intergenic
1170058981 20:12239707-12239729 TTCTGCAGGAGGGAAGAAACTGG + Intergenic
1170244418 20:14204808-14204830 TTGTGTAGGAGGCAAGTGCCTGG + Intronic
1170367211 20:15610857-15610879 TTCTGCATGAGGCCACAGCCAGG - Intronic
1170398329 20:15952441-15952463 AGCTGCAGGAAGCAAGAAGCTGG - Intronic
1170664882 20:18378269-18378291 TGCTGCTGGAGGCCAGATCTGGG - Intergenic
1170871492 20:20210507-20210529 TGATGCTGCAGGCAACAGCCAGG - Intronic
1171309775 20:24136730-24136752 TGCTCCAGGAGTCAACAGCTGGG - Intergenic
1171390667 20:24799644-24799666 TGCAGAAAGAGGCAAGACCCTGG - Intergenic
1172221211 20:33276377-33276399 TGCTGCAGGGGACAGGAGCTGGG - Intronic
1173503149 20:43567749-43567771 GGCTGCAGAAGGGAAGACCCAGG - Intronic
1173521417 20:43702988-43703010 AGCTGCATGAGGGCAGAGCCAGG - Intronic
1174168904 20:48604262-48604284 TTCTGCAGGAGGCAGGAGGGTGG + Intergenic
1174485101 20:50856002-50856024 GCCTGCGGGAGGGAAGAGCCTGG + Intronic
1174614259 20:51823874-51823896 TGCTGGAGGAGGCAATGCCCTGG - Intergenic
1174725055 20:52852572-52852594 TGCTGCTGGAATCCAGAGCCTGG + Intergenic
1175530897 20:59673754-59673776 AGCTGCAGAAGGTCAGAGCCAGG + Intronic
1175843881 20:62048754-62048776 GGCTGCAGGAGGATGGAGCCTGG - Intronic
1176025215 20:62982200-62982222 TTCTGGAGGAGGCCAGAGCTGGG - Intergenic
1176298748 21:5088546-5088568 AGCTGCTGGAGGCAGCAGCCTGG - Intergenic
1178486741 21:33024138-33024160 TGCTCCAGAAGGCACGAGACTGG + Intergenic
1179858278 21:44173403-44173425 AGCTGCTGGAGGCAGCAGCCTGG + Intergenic
1180082265 21:45492378-45492400 TGCTGCAGGAGGGATGCCCCAGG + Intronic
1180098359 21:45572260-45572282 GGCTGGAGGAGGCAAGGCCCTGG + Intergenic
1180814531 22:18781350-18781372 TGCAGGTGTAGGCAAGAGCCAGG - Intergenic
1181200719 22:21215686-21215708 TGCAGGTGTAGGCAAGAGCCAGG - Intronic
1181701022 22:24621287-24621309 TGCAGGTGTAGGCAAGAGCCAGG + Intronic
1182483493 22:30625421-30625443 TCCTTCAGCAGGCAAGGGCCAGG - Intronic
1182550188 22:31096760-31096782 GGCTGCAGGAGGCACGGGGCCGG + Exonic
1182621638 22:31621620-31621642 TCCTGCAGGAGGAAAGGGTCAGG + Intronic
1182784263 22:32893465-32893487 TCCTGCAGGAGACAATATCCTGG - Intronic
1182989731 22:34755606-34755628 CACTGCAGGAGCCAAGAGGCTGG + Intergenic
1183204008 22:36405984-36406006 TGCTGCTGGAGGCAAAATGCAGG + Intergenic
1183605159 22:38863725-38863747 GGCTTCAGGAGGCAAGAAGCTGG - Exonic
1183719510 22:39554353-39554375 TGCAGCAGCAAGGAAGAGCCTGG + Intergenic
1184244976 22:43231264-43231286 TGCAGCAGGAGCCCAGAGGCTGG - Intronic
1184317956 22:43712688-43712710 AGAAGCAAGAGGCAAGAGCCTGG + Intronic
1184374655 22:44104047-44104069 TGCAGCTGGAGGCAGCAGCCTGG - Intronic
1184378913 22:44132873-44132895 TGCTGCAGGAGGAAGGAGGAAGG - Exonic
1184989383 22:48156765-48156787 GGCTGCAGGATTCAAGGGCCAGG + Intergenic
1203226198 22_KI270731v1_random:79749-79771 TGCAGGTGAAGGCAAGAGCCAGG + Intergenic
1203264630 22_KI270734v1_random:7037-7059 TGCAGGTGTAGGCAAGAGCCAGG - Intergenic
950577044 3:13838208-13838230 TGCTGCAGGAGTGGAGACCCAGG + Intronic
950793795 3:15494358-15494380 TGTTGCAGGAGGGAAGAAGCAGG + Intronic
952332336 3:32375612-32375634 TGCTGAAGGTGGCAATAGCGTGG + Intergenic
952789799 3:37190777-37190799 TGCTGCAGAAGCTGAGAGCCCGG - Intergenic
952972427 3:38660291-38660313 TTCTGCATGTGGCAATAGCCAGG - Intergenic
953983343 3:47423805-47423827 TTATGCCGGAGGCAAGAGCAAGG + Intronic
954081649 3:48215710-48215732 TGCTGCAGAGGGCAGGAGGCAGG + Intergenic
954471140 3:50696455-50696477 TGCTGTAGGAGTTCAGAGCCTGG + Intronic
954575967 3:51676418-51676440 AGCTGCAGGAGGCAGTGGCCAGG - Intronic
955114993 3:55989083-55989105 TGCTGCTGGACGCAAGACACGGG + Intronic
957412500 3:79859641-79859663 TGCTGCAGGATTAGAGAGCCTGG + Intergenic
959787839 3:110321905-110321927 AGCTGCAAAAGGCAAGAGACTGG - Intergenic
960125592 3:113995035-113995057 TGCTGCAGGAGTCAAAAGCTCGG - Intronic
960629199 3:119711983-119712005 TGGTGGAGGAGGAAAGGGCCTGG + Intronic
961371667 3:126435304-126435326 CCTTGCAGGAGGCCAGAGCCAGG + Intronic
961631426 3:128301753-128301775 TGGGGCAGGAGGAAAGAGACTGG + Intronic
962273593 3:133996053-133996075 TTCTGTAGCAGGCAAGAGACTGG + Intronic
963940544 3:151092166-151092188 TGCTGCAGGGAGCAAGGGACAGG - Intronic
965468357 3:169060185-169060207 TGCTAAAGGAGGAAAGAGTCTGG + Intergenic
965539664 3:169859380-169859402 AGCTACAGGAGGCATGGGCCGGG + Intronic
967256081 3:187593454-187593476 GGTTGCAGTAGGCAGGAGCCTGG - Intergenic
967409739 3:189155128-189155150 AGCCGCAGGAGGAAAAAGCCAGG + Intronic
967445740 3:189564424-189564446 TGCTTCTGGAGTTAAGAGCCTGG + Intergenic
967973155 3:195014010-195014032 TTCTCCAAGAGGCAAGAGCCCGG + Intergenic
968007861 3:195255279-195255301 GGCTGCAGGAGTGCAGAGCCAGG + Intronic
968068890 3:195773853-195773875 TGCTCCAGGAGGCAGGGACCAGG + Intronic
968609080 4:1549013-1549035 TCCAGCAGGGGGCAAGCGCCCGG - Intergenic
968742542 4:2338694-2338716 CTCTGCAGGAAGCAAGAGCACGG - Intronic
968902984 4:3439866-3439888 GGCAGCAGGAGGCCAGGGCCAGG - Exonic
969414481 4:7049769-7049791 GGCTGAAAGAGGGAAGAGCCAGG + Intronic
969480602 4:7445053-7445075 TGCTGCGGGTGGCAAGAGGGAGG + Intronic
969666277 4:8559145-8559167 TGCTGCGGGAAGCTACAGCCTGG - Intronic
969943019 4:10753856-10753878 TTATGCAGGAGGCAAGGGTCAGG - Intergenic
971333670 4:25703222-25703244 TGCTGCTGACAGCAAGAGCCTGG + Intergenic
974962261 4:68718769-68718791 ACCTGCAGGAGGCAAGAGACAGG - Intergenic
976845397 4:89483426-89483448 CACAGCAGGAGGCAAGAGGCAGG + Intergenic
978456454 4:108897892-108897914 TGCGGCAGGCCACAAGAGCCTGG + Intronic
979744828 4:124199165-124199187 TGCTGCAGGATGCAAGAACAGGG - Intergenic
980582263 4:134770556-134770578 TGTAGCAGGAGACAAGAGCAAGG + Intergenic
981745005 4:148044446-148044468 GGCTGCAGGAGGCTGGACCCAGG - Intronic
982131216 4:152230420-152230442 TGCTGCAGGGGGAAGGAGACAGG - Intergenic
982306991 4:153943235-153943257 TGCTGAAGGAGGCAGAGGCCAGG + Intergenic
982885430 4:160774364-160774386 AGCAGCAGGAAGCAACAGCCTGG + Intergenic
983416663 4:167465196-167465218 TTCTGAAGGAGCCAAGAACCAGG - Intergenic
984067088 4:175062186-175062208 TGCTGCAGCAGGCACGAAACTGG + Intergenic
985510460 5:310466-310488 TGACTCAGGAGGCAAGATCCAGG - Intronic
985535395 5:462313-462335 AACGGCAGGAGGAAAGAGCCAGG - Intronic
986173720 5:5334266-5334288 GGCTGCAAGAGGCAAAACCCAGG + Intergenic
986526855 5:8688392-8688414 TGCAGCAAGATGCAAGAGGCAGG + Intergenic
987120493 5:14762375-14762397 TGCTGAAGGAGGCAAGAGTTGGG - Intronic
987946421 5:24614959-24614981 AGCTGCAGGAGTCAAGCACCAGG + Intronic
988427125 5:31076654-31076676 TGCTGCTGGAGGGAAGAGGCTGG + Intergenic
988504196 5:31807683-31807705 TGCTGGCGGATGCAAGAACCGGG + Intronic
988665737 5:33325458-33325480 TACAGCAGGAGGCAAGTGGCAGG + Intergenic
989282829 5:39665140-39665162 GGCTGCAGGAGTGAAGAGCAGGG + Intergenic
990003807 5:50922832-50922854 TCCAGCAGGGGGCAAGCGCCCGG + Intergenic
990333050 5:54746076-54746098 TGCTCCAGGAGAGAAGAGCTTGG - Intergenic
992326288 5:75663408-75663430 TGCTCCTGGAGGCCACAGCCAGG - Exonic
995844696 5:116481123-116481145 TGCTGCAAGAGGGACGAGGCAGG + Intronic
997594083 5:135094808-135094830 AGCAGCAGGAGGCCAGACCCAGG - Intronic
997713503 5:136025806-136025828 TGCTGCTGGAGGTAAGAGCAGGG - Intergenic
998151368 5:139759361-139759383 GGCAGCAGGAGGCAGGAGCAGGG - Intergenic
999328768 5:150659150-150659172 TTCTACAAGAGGCAAGAGGCAGG - Intronic
1001286987 5:170431009-170431031 TCCTGCAGGAGGGGAGGGCCTGG - Intronic
1001906065 5:175474417-175474439 TGCTGCAGGAGCCATGAAGCTGG + Intergenic
1001970045 5:175948229-175948251 TGCTACTGGAGGGAAGCGCCAGG + Intronic
1002247392 5:177895535-177895557 TGCTACTGGAGGGAAGCGCCAGG - Intergenic
1002272357 5:178080915-178080937 TGTTGCTGGAGTCAAGGGCCAGG + Intergenic
1002434081 5:179220683-179220705 TGCTGCTGGAGTCAGGAGCGTGG - Intronic
1003360349 6:5419831-5419853 TCCTGCAGGAGGCAGGCTCCTGG + Intronic
1003360500 6:5420871-5420893 TCCTGCAGGAGGCAGGCTCCTGG + Intronic
1003392958 6:5729165-5729187 TCCTGCTGCAGGAAAGAGCCAGG + Intronic
1003399136 6:5777149-5777171 TGCTGCAGGAACCACGGGCCGGG - Intergenic
1004551514 6:16652661-16652683 GGTTGCAGAAGGCAAGAGCCAGG - Intronic
1005473539 6:26185405-26185427 TGCTTCTGGTGGCAAGAGACTGG + Intergenic
1006931484 6:37691701-37691723 TGATACAGGAGGCAAGAGCAAGG - Intronic
1006948048 6:37798551-37798573 TGCGGCAGGAGGGAACAGGCAGG + Intergenic
1007322930 6:41040321-41040343 AACTGCAGGAGGCCAGACCCTGG - Intronic
1007380976 6:41489826-41489848 TGCTGCAGGAGGGAGGAGGCTGG + Intergenic
1007444509 6:41895009-41895031 GGCGGCGGGAGGCGAGAGCCGGG - Intronic
1011295789 6:85825988-85826010 TTGTGGAGGAGGCAAGTGCCAGG - Intergenic
1013808691 6:114020433-114020455 CGCTGCAGGAGGGGAGTGCCTGG - Intergenic
1014098053 6:117481898-117481920 AGCTGAAGGAGGAAAGGGCCAGG - Intronic
1014875204 6:126649999-126650021 TCCTCCAGGAGGCAAAAGTCTGG + Intergenic
1016662990 6:146602722-146602744 TGCAGCAGGAGGTGAGAGGCAGG + Intronic
1017326734 6:153149713-153149735 TTCTGCAGGAGGCACAAGCATGG + Intergenic
1018164885 6:161083867-161083889 TGCAGCAGGAGGTAAGTGCTAGG - Intronic
1018747972 6:166777127-166777149 TGCTGCGGGAGGCCTGAGCAGGG + Intronic
1018748582 6:166781749-166781771 TGCACCAGGAGCCAGGAGCCAGG + Intronic
1019194338 6:170272465-170272487 TGATGCTGGAGGGAAGAACCTGG + Intergenic
1020017212 7:4838135-4838157 TTCTGCAGGCGGCAGGAGCACGG - Intronic
1021954411 7:25810074-25810096 TGCTGGAGGAAGCAAGAGATGGG - Intergenic
1022498807 7:30869819-30869841 TGCTGCAGGAGGGGAGACCGAGG + Intronic
1022585584 7:31605555-31605577 TGCTACAGGAGACAAGAACTAGG - Intronic
1022993363 7:35729865-35729887 TGCTGGGGGAAGCAAGAGCAGGG + Intergenic
1024136257 7:46412197-46412219 GGCTGCAGGAGTCATGAGCCAGG + Intergenic
1024250554 7:47502766-47502788 ACCTGCAGGAGCCAAGAGGCTGG + Intronic
1026155469 7:67822102-67822124 TGGTGGAGGAGACAAGAGACTGG + Intergenic
1031069903 7:117150573-117150595 AGCTGCAGGCAGGAAGAGCCAGG - Intronic
1032724821 7:134580882-134580904 GGCTGGAGAAGGGAAGAGCCAGG + Intergenic
1033228645 7:139580092-139580114 GGCTGCAGAAGGCAAGAAGCAGG - Intronic
1033331169 7:140417980-140418002 AGCTGCCTGAGGCCAGAGCCTGG + Intronic
1034288805 7:149910970-149910992 AGCTTCTGGAGGCAAGACCCAGG + Intergenic
1034490886 7:151392519-151392541 AGCTGCAGGAGGCATGGGCAAGG - Intronic
1034662272 7:152781897-152781919 AGCTTCTGGAGGCAAGACCCAGG - Intronic
1035327276 7:158073307-158073329 GGCTGCAGGAGGAAGGAGCATGG + Intronic
1036166371 8:6437850-6437872 TGGTGCAGGAGGGATGATCCAGG - Intronic
1036381281 8:8237906-8237928 TCCTGCAGGAGGCCTGGGCCTGG - Intergenic
1036676020 8:10833780-10833802 GGCTGCGGGAGGCAAGAGGGCGG + Intronic
1037687023 8:21149416-21149438 TGCTGTAGTAGGCAGGAGCAGGG - Intergenic
1037767303 8:21780182-21780204 TCCTGCTGGAGGGAGGAGCCTGG - Intronic
1037985793 8:23289899-23289921 TGGGGCAGGAGGCAGGAGCGCGG - Exonic
1038427009 8:27470196-27470218 TGCTGCAGGTGGCGAGGGGCAGG + Intronic
1038715909 8:29990957-29990979 TGCTGCAGATGGCAAAAGCGAGG + Intergenic
1039328273 8:36508975-36508997 AGCTGCATGTGGGAAGAGCCAGG + Intergenic
1039469129 8:37802754-37802776 TGCTGCAGGATGTTAGAGTCAGG + Intronic
1039828046 8:41191560-41191582 AGCTGGAGAAGGCAAGACCCTGG + Intergenic
1039988905 8:42471055-42471077 TGCAGCAGGAGGTAAGATGCTGG - Intronic
1040614675 8:49022360-49022382 AGAAGCAGGAGGCAGGAGCCAGG - Intergenic
1041426061 8:57721923-57721945 TGTGGTAGGAGGAAAGAGCCTGG - Intergenic
1044300400 8:90576938-90576960 GGCTGGATGAGGCAAAAGCCAGG - Intergenic
1044852799 8:96445612-96445634 AGCCGCAGGAAGCAAGAGGCGGG + Intergenic
1047372669 8:124268929-124268951 TGGAGCAGGAGGCAAGGGGCTGG + Intergenic
1047402438 8:124558032-124558054 TGATGCAAGAGAAAAGAGCCGGG + Intronic
1048054104 8:130846978-130847000 TGCTGCAGAAGGAAAGAGGGAGG - Intronic
1048499006 8:134959024-134959046 TGCTGCAGAAGGCTTGAGACTGG + Intergenic
1049252863 8:141598485-141598507 AGCTGCAGGCTGCATGAGCCTGG + Intergenic
1049528045 8:143138997-143139019 TGCTGCAGGTGGTACCAGCCAGG - Intergenic
1049536989 8:143187065-143187087 TGATGCAGGAGGCATGTGCCTGG + Intergenic
1049796744 8:144500469-144500491 TGCAGCTGCAGGCAAGCGCCCGG - Exonic
1052249047 9:26375592-26375614 TCCAGCAAGAAGCAAGAGCCAGG + Intergenic
1055112570 9:72574339-72574361 TGCTGGAGCAGCCAAGAGCTTGG - Intronic
1056376123 9:86013134-86013156 TGCAGGATGAGGTAAGAGCCAGG + Exonic
1059282683 9:113148485-113148507 GGCTGGAGGAAGCAGGAGCCAGG - Intergenic
1059348228 9:113646699-113646721 GGCAGCAGGAGGCAGGGGCCAGG - Intergenic
1059820148 9:117963623-117963645 AGCTGAAGGAGGGGAGAGCCAGG - Intergenic
1059962465 9:119578713-119578735 GCCTGGAGGAGACAAGAGCCGGG - Intergenic
1060195344 9:121620127-121620149 TGCAGCAGGGGGTCAGAGCCGGG - Intronic
1060204892 9:121676715-121676737 TGCTGTAGGAGCCAAAAGCGAGG + Intronic
1060482390 9:124024335-124024357 TGCTGCTGGATACAGGAGCCAGG + Intronic
1061034402 9:128105725-128105747 TGCTGCGGGAGGCATGGACCTGG - Exonic
1061527010 9:131174238-131174260 TGCTGCATGGGGCAAGAGACTGG - Exonic
1061622210 9:131818036-131818058 TGTGCCAGGAGCCAAGAGCCAGG - Intergenic
1061955787 9:133960690-133960712 GGCTGGGGGAGGAAAGAGCCTGG - Intronic
1062277539 9:135737886-135737908 AGCTGCAGGAGGCTGCAGCCAGG - Intronic
1062323187 9:136000561-136000583 TGCTGTATGAGGAAAAAGCCAGG + Intergenic
1062462423 9:136667485-136667507 TGCAGCAGGAGCCAGGGGCCCGG - Intronic
1187279143 X:17844143-17844165 TGCTGCAGGAGGCAAAAAGTGGG - Intronic
1187417565 X:19106249-19106271 TGCTGCAGGTTGGAAGTGCCAGG - Intronic
1188869913 X:35360301-35360323 TTTTGCAGGAGGGAAGAGCCCGG + Intergenic
1189524513 X:41805696-41805718 AGCTCCAGGATGGAAGAGCCAGG + Intronic
1199904075 X:152206740-152206762 TGCTGCTGGGGTCAAGTGCCTGG - Intronic
1202134048 Y:21642058-21642080 TGGAGCAGCTGGCAAGAGCCAGG - Intergenic