ID: 923008997

View in Genome Browser
Species Human (GRCh38)
Location 1:230073471-230073493
Sequence GTTTCACCCTGTGCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923008997_923009002 30 Left 923008997 1:230073471-230073493 CCTCCTGCAGCACAGGGTGAAAC No data
Right 923009002 1:230073524-230073546 TAGTATGGGCCCCAGAAGCATGG 0: 1
1: 0
2: 3
3: 10
4: 115
923008997_923009001 16 Left 923008997 1:230073471-230073493 CCTCCTGCAGCACAGGGTGAAAC No data
Right 923009001 1:230073510-230073532 TTAGTCATGTCTACTAGTATGGG 0: 1
1: 0
2: 0
3: 1
4: 71
923008997_923009000 15 Left 923008997 1:230073471-230073493 CCTCCTGCAGCACAGGGTGAAAC No data
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923008997 Original CRISPR GTTTCACCCTGTGCTGCAGG AGG (reversed) Intronic
No off target data available for this crispr