ID: 923009000

View in Genome Browser
Species Human (GRCh38)
Location 1:230073509-230073531
Sequence CTTAGTCATGTCTACTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923008997_923009000 15 Left 923008997 1:230073471-230073493 CCTCCTGCAGCACAGGGTGAAAC No data
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54
923008994_923009000 26 Left 923008994 1:230073460-230073482 CCTGGCTCTTGCCTCCTGCAGCA 0: 1
1: 0
2: 2
3: 39
4: 426
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54
923008998_923009000 12 Left 923008998 1:230073474-230073496 CCTGCAGCACAGGGTGAAACACT 0: 1
1: 0
2: 0
3: 19
4: 441
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54
923008993_923009000 30 Left 923008993 1:230073456-230073478 CCTGCCTGGCTCTTGCCTCCTGC 0: 1
1: 0
2: 15
3: 82
4: 658
Right 923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923009000 Original CRISPR CTTAGTCATGTCTACTAGTA TGG Intronic
901357608 1:8664774-8664796 CTTAGTTCAATCTACTAGTATGG + Intronic
905812768 1:40925193-40925215 GTTAGGCATGGCTATTAGTATGG + Intergenic
917178434 1:172265106-172265128 TTTAGTCATGGCTATTTGTATGG + Intronic
918566793 1:185943514-185943536 CTGAGTCATATCTACAAGGAAGG - Intronic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
923908730 1:238415389-238415411 CTTAGTAATGTGTGCTAGGAGGG + Intergenic
1064616089 10:17158506-17158528 AAAAGTCATGTCTACTAATAAGG - Intronic
1068794686 10:61066429-61066451 CTCAGTCAGGTGTACTAGTTAGG + Intergenic
1084071236 11:66736868-66736890 GCTAGTCATGTCAACTACTATGG + Intergenic
1085194563 11:74660960-74660982 CTTGGTCAATTCTACTATTAAGG + Intronic
1085537176 11:77228911-77228933 CTTAGTCAAGCCTATTACTATGG - Intronic
1091079294 11:132651550-132651572 CCTAGTCATGTTTACAAATAAGG - Intronic
1098456785 12:70683398-70683420 CTTAGAAAAGACTACTAGTATGG + Intronic
1100162250 12:91874134-91874156 CTTAGTCATGTGTTGTATTAGGG + Intergenic
1108419299 13:50232713-50232735 CTTTGTCATGTTTACTGATATGG + Intronic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1116553271 14:46270008-46270030 ATTATTCATTTATACTAGTATGG + Intergenic
1131694591 15:94862477-94862499 GTGACACATGTCTACTAGTAAGG + Intergenic
1137567102 16:49540088-49540110 CTTGGTCATGTCCAGTAGGAAGG - Intronic
1146714632 17:35074814-35074836 CTTATTCTTGTCTAAAAGTATGG - Intronic
1148785412 17:50143872-50143894 CTTTGCCAAGTCTACTAGGATGG + Intronic
1149863662 17:60138702-60138724 CTTAGGAATGTCCACTAGTCAGG - Intergenic
1150360395 17:64527809-64527831 CTCAGTCATGTCCAGCAGTAGGG - Intronic
1155625593 18:27830928-27830950 GTTAGACATGTCAAGTAGTATGG - Intergenic
1160089585 18:75813882-75813904 CTTGGTCATGTCTAATATTGAGG + Intergenic
944265384 2:197719092-197719114 CATAGTTATGTCTACAAATATGG + Intronic
1173968305 20:47130620-47130642 CTTTGTCATGTCTTCTATTGCGG - Intronic
1177648651 21:23932921-23932943 CTTAGGCATGTCTACAATTAAGG + Intergenic
1183170284 22:36182834-36182856 CTTAGACATGGCTACGAGTTGGG - Intergenic
1183751881 22:39725563-39725585 CTGAGTCATGTCTGCTATTCGGG - Intergenic
950839445 3:15952781-15952803 CTTTGTCATGTGTATTAGTCAGG - Intergenic
956256488 3:67288718-67288740 ATTATTTATGTATACTAGTATGG + Intergenic
957961307 3:87257048-87257070 GTTTGTCATTTCTACTAGTTTGG - Intergenic
963963938 3:151343987-151344009 CATAGTCATGTCTGCTAGCTTGG + Intronic
970781442 4:19742569-19742591 CTTTATCATGTTTACTAGCATGG - Intergenic
976954611 4:90880270-90880292 CTTAGCCATAACTACTACTAAGG - Intronic
982111829 4:152063703-152063725 CTTCCTCATGTCTAGTAGTGTGG + Intergenic
991975510 5:72180210-72180232 CTTGCTCAAGTCTACTTGTATGG + Intronic
993532440 5:89041138-89041160 CTTAGGCATTTATACTTGTAAGG + Intergenic
993818443 5:92583116-92583138 GTGAGTCATGTCTACTATTGGGG + Intergenic
994359256 5:98831622-98831644 CTTAGTCATTTCTACTTATTTGG + Intergenic
997024109 5:130037596-130037618 CTTAATCATGCCTACTTGTCAGG + Intronic
1007040120 6:38714152-38714174 CTGAGTAATGTCTATTAATATGG + Intergenic
1010212104 6:73370064-73370086 CTTCGTCATCTCTGCTCGTAAGG + Intronic
1012799818 6:103811389-103811411 CTTGGTCATATCTACTTGCAAGG - Intergenic
1015304534 6:131692534-131692556 TTTACTCATATCTACTAATATGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1023123094 7:36929018-36929040 CTTAGTAATCTCCACTATTAGGG - Intronic
1023713387 7:43018604-43018626 CTTAGTCATCTCTAAGAGCAAGG + Intergenic
1036074066 8:5475101-5475123 CTTAAACATGTCTACTTGGAGGG + Intergenic
1042007812 8:64201839-64201861 CATAGTCATGTCCAAAAGTATGG - Intergenic
1047035571 8:120935054-120935076 CTCAGTCATGTCTACTGACAAGG + Intergenic
1187637156 X:21242399-21242421 CTTAGACATGTCTTTTAGTGGGG - Intergenic
1189208899 X:39266118-39266140 TTTACTCATGTCTCCTATTATGG - Intergenic
1202040261 Y:20675189-20675211 CTCAGTGATGTCTCCTAGTTAGG - Intergenic