ID: 923012960

View in Genome Browser
Species Human (GRCh38)
Location 1:230103645-230103667
Sequence GTTCTAAGGAGACAAGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923012954_923012960 12 Left 923012954 1:230103610-230103632 CCCAGGAAAGAGATTCTTGCAGG 0: 1
1: 0
2: 4
3: 20
4: 226
Right 923012960 1:230103645-230103667 GTTCTAAGGAGACAAGTAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 130
923012956_923012960 11 Left 923012956 1:230103611-230103633 CCAGGAAAGAGATTCTTGCAGGA 0: 1
1: 0
2: 0
3: 14
4: 238
Right 923012960 1:230103645-230103667 GTTCTAAGGAGACAAGTAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923012960 Original CRISPR GTTCTAAGGAGACAAGTAGG TGG Intronic
903782598 1:25831070-25831092 GATCTGAGGACACAAGTGGGAGG - Intronic
903996405 1:27307714-27307736 GTTTTAAGAAGACAAGTGGAGGG + Exonic
909375495 1:74936938-74936960 GTACAAAGGAGAAATGTAGGAGG - Intergenic
916657793 1:166892755-166892777 CTTATAAGGACACAAGTAGTTGG - Intergenic
919470663 1:197975282-197975304 GTTCTTAGGAAACACGTATGAGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920920674 1:210294917-210294939 GCCCTGAGGAGAAAAGTAGGTGG - Intergenic
923012960 1:230103645-230103667 GTTCTAAGGAGACAAGTAGGTGG + Intronic
923257378 1:232233333-232233355 GTACTGAGGAGACAGGTGGGAGG + Intergenic
924422791 1:243924984-243925006 TTTCTAAAGAGACAAGAAGATGG - Intergenic
924770520 1:247075971-247075993 TTTCCAAAGAGACAAGAAGGAGG - Intronic
1063663701 10:8049907-8049929 GTTCAAAGGAGAGAAGCCGGAGG - Intergenic
1065103329 10:22353807-22353829 GTTCAAGGGAGACATCTAGGAGG + Intronic
1066368221 10:34797146-34797168 GTTCCAAGGAGCTAAGTAAGTGG + Intronic
1071509371 10:86251550-86251572 GTTCTAGGGAGGCAAGCAGAGGG - Intronic
1074321058 10:112402822-112402844 GTTATAAGTAGACAAGTAGAAGG - Intronic
1074612394 10:115034651-115034673 GCTGTAAGGAGACAAGGAGGTGG + Intergenic
1078158706 11:8821216-8821238 GTTCTAAGGAGAAAAGAGGGTGG + Intronic
1079022335 11:16919429-16919451 CTTCTCAGGAGACAGGCAGGAGG + Intronic
1082614677 11:55344162-55344184 GTTCTAAGGCAACAAATAGGCGG + Exonic
1083661951 11:64255553-64255575 GTTCTCAGCAGACAAGAAGCGGG + Exonic
1086472480 11:87130059-87130081 TTTCTTAGGATACAAGTAGCAGG + Intronic
1087357791 11:97116832-97116854 GCTATAAGCAGACAAGTAGAAGG + Intergenic
1088224000 11:107599089-107599111 GTGCTATGAGGACAAGTAGGAGG + Intronic
1091023378 11:132121080-132121102 GTTCACAGGAGAAAAGTAGAAGG + Intronic
1092510772 12:9153829-9153851 GTTGAAAGAAGACATGTAGGAGG + Intronic
1092641367 12:10514222-10514244 ATTTTGATGAGACAAGTAGGAGG - Intronic
1092930026 12:13307102-13307124 GTTAGAAGGAGAAAAGTTGGAGG + Intergenic
1097830513 12:64219879-64219901 GTTCTAATGAGCAAAGTAGTTGG + Intronic
1097966015 12:65582098-65582120 GTTCCAAAGAGAAAGGTAGGAGG - Intergenic
1104322995 12:127769784-127769806 GTTCAAAGGAGAAAATGAGGAGG + Intergenic
1104813866 12:131634590-131634612 GTTCCCAGGAGACAAGCAGGTGG - Intergenic
1108545384 13:51488284-51488306 GTGCTAACTAGACAAGTAAGAGG + Intergenic
1110223586 13:73097133-73097155 GTTCTAAGGAGATAATTCGCAGG - Intergenic
1120728083 14:87968979-87969001 GTTCTAAGGACAGGAGTAGTGGG - Intronic
1122080394 14:99263063-99263085 GTTATTAGGACACAAGTTGGGGG + Intronic
1122084523 14:99290452-99290474 GTTCTATGGAGACAAAGATGAGG + Intergenic
1124989828 15:34660864-34660886 ATTCTAGGGACACAATTAGGAGG - Intergenic
1125143412 15:36437164-36437186 GTTTTAAGGAGAAAAGCAGGGGG + Intergenic
1125793097 15:42384728-42384750 GTGCTAAAGAGGCATGTAGGAGG - Intronic
1126648423 15:50897845-50897867 CTTCTAAGGAGGAAAGTAGGAGG + Intergenic
1127852307 15:62924541-62924563 GTCCTAAGTAGACTATTAGGGGG - Intergenic
1128762372 15:70226109-70226131 GGTCTAGGTAGACAAGAAGGAGG + Intergenic
1134342288 16:13356697-13356719 GTTCTGAGGGGACAGGTGGGAGG + Intergenic
1134693405 16:16205721-16205743 GTTCTAACGAGACAAAGAGAGGG - Intronic
1134978447 16:18588979-18589001 GTTCTAACGAGACAAAGAGAGGG + Intergenic
1138455457 16:57118119-57118141 GTGTTAAGGAGACGAGAAGGAGG - Intronic
1140480333 16:75259006-75259028 TTTCTAAGGAGAGCAGGAGGCGG - Intronic
1140869628 16:79094767-79094789 GTTTTAAAGAGACAAGAGGGAGG + Intronic
1144018844 17:11222253-11222275 GTTTTAGGGACACAAGGAGGGGG + Intergenic
1146135469 17:30317061-30317083 GTTCAAAGGAGAATAGAAGGTGG - Intronic
1150822219 17:68444878-68444900 GTTCTAAGGAAAGAAGGAGAAGG - Intronic
1151223189 17:72628834-72628856 CTTCAAAGGAGGGAAGTAGGAGG + Intergenic
1151339963 17:73464817-73464839 GTTCTAAGGAGAGATGAAGCTGG - Intronic
1158158612 18:54454418-54454440 GATGCAAGGAGACAAGTAGAAGG - Intergenic
1159539432 18:69756268-69756290 GTTCTAAGGAGACAAGTTTCTGG - Intronic
1165219925 19:34307175-34307197 GTTCTGAGTAGCCAGGTAGGAGG + Intronic
924999055 2:390669-390691 GCTGTAAGGAGAAAAGTAAGTGG - Intergenic
930711287 2:54553209-54553231 GTTTTAGGGAGAAAAGAAGGTGG + Intronic
931881132 2:66572174-66572196 GTCTTAAGGAGACTGGTAGGAGG + Exonic
933850917 2:86365806-86365828 GTGCACAGGAGACAACTAGGAGG + Intergenic
934776913 2:96945031-96945053 GTTCTCAGGAGGCTAATAGGTGG - Intronic
935043797 2:99460560-99460582 GATGTAATAAGACAAGTAGGAGG - Intronic
935465106 2:103387407-103387429 GTTCTAAGCAGACATTTATGGGG - Intergenic
937186191 2:120045559-120045581 AGTCTAAGGAGACAAGATGGTGG - Intronic
937814534 2:126236844-126236866 TTGCTAAGAAGAAAAGTAGGAGG + Intergenic
944500770 2:200357447-200357469 TTTCTTTGGAGACAGGTAGGTGG + Intronic
945301591 2:208220400-208220422 GTACTGAGGGGACAGGTAGGAGG + Intergenic
946133934 2:217629889-217629911 GTCCTAAGGTGGCAAGAAGGAGG - Intronic
947557711 2:231111220-231111242 GTTCTAAGTAGACTTGTAGATGG - Intronic
947744125 2:232498938-232498960 GTTCTAAGGAATCAAGCTGGGGG + Intergenic
1170546043 20:17436642-17436664 GTTCGCAGGAGACAAGGAGGTGG - Intronic
1173116059 20:40244198-40244220 GAGCTAAGGAGCCAAGTAGGAGG - Intergenic
1173339235 20:42138866-42138888 GATTAAAGGGGACAAGTAGGAGG - Intronic
1174029808 20:47613946-47613968 GCTGTGAGGAGATAAGTAGGAGG - Intronic
1174478711 20:50815786-50815808 GTTCTCTGGGGACAAGTGGGTGG + Intronic
1178781555 21:35607810-35607832 CTTTTAGGGAGAAAAGTAGGGGG + Intronic
1178793003 21:35717534-35717556 GTGCTAGGGAGTCAAGCAGGAGG + Intronic
1179575552 21:42306324-42306346 GTTGTAAGGATATAAGTAGAAGG - Intergenic
1180850941 22:19019841-19019863 GTTCCCAGGAGAAGAGTAGGAGG - Intergenic
1182017440 22:27052539-27052561 GTTCTCAGGAGACAGGGAGAAGG + Intergenic
1183374284 22:37453998-37454020 GGTCTAAGGAGAGAAGGAGAAGG - Intergenic
949825957 3:8166160-8166182 GTTCTAAGAGGACGAGTAGAAGG - Intergenic
950011403 3:9726757-9726779 GAACTAAGGAGAAAAGTGGGAGG + Intronic
951173721 3:19574702-19574724 GGTCTTAGGAGACATGTATGTGG - Intergenic
953128194 3:40111809-40111831 GTGCTAAGAAGGCAAGCAGGTGG + Intronic
954756184 3:52841474-52841496 GGTCTAAGGAGCCAGGCAGGCGG - Intronic
955834820 3:63043368-63043390 TTTCTAAGGAGACAAGTTCAAGG - Intergenic
958420075 3:93919140-93919162 GTACTAAGGAGACATGCATGAGG - Intronic
959077045 3:101760255-101760277 GGTGTAAGGAGAGAAGTATGAGG + Intronic
959499255 3:107086925-107086947 GTGATATGGAGACAAGTAGGGGG + Intergenic
959499375 3:107087960-107087982 GTGATATGGAGACAAGTAGGGGG - Intergenic
959615400 3:108341875-108341897 GTTGTGAGGAAACAAGTAGGGGG - Intronic
959633207 3:108532372-108532394 GCTCTAAGGAGTCAAACAGGAGG - Intergenic
962539870 3:136370262-136370284 GTTCCAATGAGACATGTGGGAGG + Intronic
964405641 3:156345966-156345988 GTTCTAAAGAAACAAATGGGAGG + Intronic
964979721 3:162664835-162664857 GTTCTAATGAGACAGTCAGGTGG + Intergenic
970635026 4:17999726-17999748 GTTTTAAGGACACTAGTAGGTGG + Intronic
970962865 4:21893553-21893575 TGTCTAAGGAGAAAATTAGGGGG - Intronic
972543982 4:40062872-40062894 GTGCTAAGGACACAAAGAGGAGG - Intronic
974624503 4:64405308-64405330 GTGATAAAGACACAAGTAGGAGG + Intronic
975001456 4:69227592-69227614 TTTATAAGGAGAAAGGTAGGAGG - Intergenic
975003986 4:69264486-69264508 TTTATAAGGAGAAAGGTAGGAGG + Intergenic
975012346 4:69373083-69373105 TTTATAAGGAGAAAGGTAGGAGG + Intronic
975812364 4:78182391-78182413 GATCTTAGAAGACAAGTAAGAGG + Intronic
976131038 4:81884262-81884284 GTTTTAAGCAGACATGTATGAGG + Intronic
977501142 4:97839236-97839258 ATTCTCATGAGGCAAGTAGGTGG + Intronic
978647348 4:110951968-110951990 GTACTAAATAGACAAGTAGAAGG + Intergenic
979897891 4:126183508-126183530 GTACTGTGGAGACATGTAGGAGG + Intergenic
982845967 4:160252903-160252925 GTTCCAAAGATACAATTAGGTGG + Intergenic
982878071 4:160672203-160672225 GTTCTAAGGCTACAAATAGAAGG + Intergenic
986808906 5:11335053-11335075 CTACTAAGAAGACAAGAAGGAGG - Intronic
992833165 5:80615166-80615188 ATTCAATGGAGACCAGTAGGAGG + Intergenic
993683728 5:90912252-90912274 CTTCTAAGGAAGCAAGCAGGAGG + Intronic
996409203 5:123138797-123138819 GGTCTAAGGAGAGAAGCAGCAGG + Intronic
999114426 5:149149987-149150009 GTTCCAAGGAAAGAACTAGGAGG + Intronic
1003176185 6:3753269-3753291 GTTCCAAGGAGACGAATAGTTGG - Intergenic
1005403542 6:25460813-25460835 TCTCTAAGGAGACAAGTACAAGG - Intronic
1006925794 6:37654541-37654563 GTGCTAAGAGGACAAGGAGGGGG + Exonic
1011897026 6:92240964-92240986 GTTCTAAAAAGACTAATAGGAGG + Intergenic
1013770007 6:113617847-113617869 GTTCTGGGGAGACAAGTACTTGG - Intergenic
1020806755 7:12799438-12799460 TTTCTAAGGAGACATGGGGGAGG + Intergenic
1026289113 7:68990021-68990043 GTTCCAAGGGGACAAATATGTGG + Intergenic
1030219481 7:107082342-107082364 TTTCTAAGGACACAAATGGGGGG - Intronic
1031691536 7:124794108-124794130 GTTTTAAGGAGACAAGTCTGTGG - Intergenic
1035978928 8:4346765-4346787 ATTCAAAGGAGACAAGTCAGTGG + Intronic
1037699514 8:21262076-21262098 CTTCTAAGGAAACAAGGAGTGGG + Intergenic
1038486906 8:27942330-27942352 GTTCTAGGGAGAGCAGTAGTGGG - Intronic
1046523986 8:115360462-115360484 TTTTTAAGGAGACAGGTAGATGG + Intergenic
1049202035 8:141345049-141345071 CCTCTAAGGGGACAAGTTGGGGG - Intergenic
1051276566 9:15404575-15404597 GTGCCAAGGTGACAAGTAGGTGG - Intergenic
1051422653 9:16904096-16904118 GGTCTCAGGAGACAAGTTAGAGG + Intergenic
1052887005 9:33659163-33659185 GTTCTAAAGAGACTTGTAGATGG - Intergenic
1054782319 9:69176396-69176418 GATCTAAAGATACAAGTAGGAGG + Intronic
1055521291 9:77083472-77083494 CTTCAAAGGAGACAAGGAGAAGG + Intergenic
1056141015 9:83679767-83679789 GATATAATGAGACAAGTATGTGG - Exonic
1056199845 9:84264736-84264758 GCTATTAGGAGACAAGTAGCAGG + Intergenic
1056243775 9:84673623-84673645 GTTCTAAGAACACAAATAGTGGG + Intronic
1059203176 9:112437927-112437949 GTTCTACGGAGAGAACTGGGTGG - Intronic
1060649036 9:125308857-125308879 GTTCTGAGGAGATAAATATGAGG + Intronic
1188434940 X:30148909-30148931 GTTCTCAGGAGACCAGAAGTGGG - Intergenic
1195646125 X:107232574-107232596 GCTCTGAGGAGAAAAGGAGGAGG + Intronic
1196376245 X:115036148-115036170 CTTCTAACCAGACAAGTATGTGG + Intergenic
1196487436 X:116229207-116229229 TTTCTAAGGAGAAAAATAGTTGG + Intergenic
1197837918 X:130714844-130714866 GTGCTAAGGAGAGAAGGTGGTGG + Intronic
1198494717 X:137180387-137180409 TTTAAAAGGAGACAAGAAGGGGG - Intergenic
1198784762 X:140274631-140274653 GTTCTAAGGAAAAAAGTACATGG + Intergenic
1201695410 Y:16818666-16818688 GTGCCAATGATACAAGTAGGGGG - Intergenic