ID: 923013558

View in Genome Browser
Species Human (GRCh38)
Location 1:230108136-230108158
Sequence AACCAGTTCCACGTGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923013558_923013561 -5 Left 923013558 1:230108136-230108158 CCCTGAGCCACGTGGAACTGGTT 0: 1
1: 0
2: 0
3: 10
4: 91
Right 923013561 1:230108154-230108176 TGGTTTGCCTGTGAAGCAATAGG 0: 1
1: 0
2: 2
3: 6
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923013558 Original CRISPR AACCAGTTCCACGTGGCTCA GGG (reversed) Intronic
910718891 1:90263244-90263266 AACCACTGCCACGTGGCAAAAGG - Intergenic
911716795 1:101142511-101142533 ATCCAGTTCCATGTGGCTGAAGG + Intergenic
920363520 1:205435861-205435883 AAACAGTTCCCCCTGGCTGAGGG + Intronic
920750387 1:208669286-208669308 AACCATTTCCACTTGTCTCCTGG + Intergenic
923013558 1:230108136-230108158 AACCAGTTCCACGTGGCTCAGGG - Intronic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1065846746 10:29750457-29750479 AACCACTTCTAGGAGGCTCAGGG + Intergenic
1067989101 10:51189485-51189507 AACTAGTTCCCTGTGGCCCATGG + Intronic
1068400158 10:56518179-56518201 TTACAGTTCCACATGGCTCAGGG + Intergenic
1068403014 10:56554623-56554645 AAGCAGTTACAAGTGGCTGAAGG - Intergenic
1072386979 10:94940784-94940806 AACAAGTGCCATGTGGCTTATGG + Intronic
1075495286 10:122914484-122914506 AAGCAGTTCCAGGAGGCTTAGGG - Intergenic
1078281835 11:9910009-9910031 AATCAGTTCCACGTGGGTGAAGG + Intronic
1083126459 11:60572339-60572361 AACCAGTGCCACATAGCACAGGG + Intergenic
1088775099 11:113074969-113074991 AAACAGCTTCATGTGGCTCATGG + Intronic
1089494293 11:118900617-118900639 ACCCTGTTCCATGTTGCTCAGGG + Exonic
1091914610 12:4261537-4261559 ACTCAGTTCCATGTGGCTGAGGG - Intergenic
1101908042 12:108842396-108842418 AACCAGTTCCACGAGGCTGGTGG - Intronic
1107014374 13:35696628-35696650 GAGCAGTGCCACGGGGCTCATGG + Intergenic
1110532324 13:76611809-76611831 AACCAGTTACACATGGCAGATGG + Intergenic
1115763703 14:36601104-36601126 CACCAGTTCCACCCGGCTCAAGG - Intergenic
1118538938 14:66801832-66801854 CACCAGCTCCAGGTAGCTCAAGG - Intronic
1127764155 15:62168386-62168408 ATCCAGATCCATCTGGCTCATGG + Intergenic
1128113616 15:65092086-65092108 AACAACTTCCACGTTTCTCAGGG - Intergenic
1133512276 16:6471689-6471711 AACCTCTTCCCTGTGGCTCATGG - Intronic
1136116537 16:28098228-28098250 GACCAGGCGCACGTGGCTCATGG - Exonic
1139492622 16:67294519-67294541 AACCACTACCACCGGGCTCAGGG - Intronic
1140154466 16:72408940-72408962 AAACAGTTCCAAGTGGCTGGGGG + Intergenic
1141131508 16:81440751-81440773 AAGCAGTGTCACGTAGCTCAGGG + Intergenic
1141835504 16:86536406-86536428 AATCTCTTCAACGTGGCTCATGG + Intronic
1142376105 16:89707885-89707907 CAGCAGCTCCACGTAGCTCAGGG + Exonic
1153826038 18:8875678-8875700 AATCAGTTCCCTGTGGCTGAGGG + Intergenic
1158041595 18:53101171-53101193 AGCTAGTTCCAGGTGGCCCAAGG + Intronic
1158552219 18:58445954-58445976 AACCAGTTTAACGTTCCTCACGG - Intergenic
1166531307 19:43545151-43545173 ACCCAGTTCCTCGTGGGTGATGG - Intronic
1166705869 19:44907729-44907751 AACAAGTTCAAGGTGGGTCAGGG - Intronic
925469355 2:4142527-4142549 ACCCAGTTCGCCCTGGCTCAGGG - Intergenic
927152317 2:20203137-20203159 AACCAGTCCCCAGTGGATCAGGG - Exonic
928749787 2:34458088-34458110 TCACAGTTCCACATGGCTCAGGG - Intergenic
929524924 2:42693142-42693164 CCCCAGTTCCAGGTAGCTCAAGG - Intronic
930709620 2:54537958-54537980 AAACAGTTCCATGTGGTTCCAGG - Intronic
930805973 2:55490920-55490942 AACCAGCTTGAGGTGGCTCAAGG - Intergenic
931486680 2:62700773-62700795 CAGTAGTTCCAAGTGGCTCATGG + Intronic
932570286 2:72934873-72934895 AACCAGTCCCCAGTGACTCAGGG + Exonic
932953099 2:76316833-76316855 AACAAGGTCCATGTGCCTCACGG - Intergenic
933338080 2:80985381-80985403 AACCAATTCCACCTGGATCCAGG - Intergenic
935798941 2:106673073-106673095 GAATAGTTCCACGTGGATCAAGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936813760 2:116434098-116434120 AAGCAGTTCCACATGGCTGGGGG + Intergenic
936820261 2:116511213-116511235 AACCAGTTTCACCTGGGTGATGG - Intergenic
939269474 2:139918870-139918892 AACCAGTTCTGTGTGGCTCAGGG + Intergenic
942276595 2:174327896-174327918 AACCCCTTCCAGGTGGATCACGG - Intergenic
944590586 2:201213773-201213795 AACAAGTACCATGTGGCTTACGG + Intronic
947058666 2:226136866-226136888 AACCGGATGCCCGTGGCTCACGG + Intergenic
1169752708 20:9010971-9010993 TTACAGTTCCACGTGGCTGAGGG - Intergenic
1174167770 20:48597633-48597655 CCCCAGGTCCACGTGGCCCAAGG + Intergenic
1174460399 20:50678363-50678385 AATCTGTCCCACCTGGCTCAGGG + Intronic
1180092237 21:45539077-45539099 AACCAGGGCCACGTGGCACCTGG - Intronic
1184313658 22:43665548-43665570 GACCCGTGCCACGTAGCTCAGGG + Intronic
1185134321 22:49060589-49060611 ATCCAGTGCCATGTGGCTCTTGG - Intergenic
1185383855 22:50522686-50522708 AACCAGCTCCTCGTAGCTCAGGG - Exonic
962974411 3:140433608-140433630 ATCCAGTTCCATTTGACTCAAGG + Intronic
968853048 4:3096593-3096615 ACCCATTTCCACATGGCCCATGG + Intronic
979947170 4:126846777-126846799 AACTTGTTCCAGGTGTCTCATGG + Intergenic
981751354 4:148095277-148095299 AAGCAGAGCCACATGGCTCAGGG - Intronic
985937725 5:3109643-3109665 AGCCACTTCCATGTGGCTCCTGG - Intergenic
986364381 5:7016206-7016228 ATCCTGTTTCTCGTGGCTCACGG + Intergenic
987556061 5:19451421-19451443 CAGTAGTTCCATGTGGCTCATGG + Intergenic
988068614 5:26256965-26256987 AACCAGTTCTTCGTGGCTATAGG - Intergenic
988185300 5:27853259-27853281 TCACAGTTCCACGTGGCTGAGGG - Intergenic
995122549 5:108551731-108551753 AACTTCTTCCATGTGGCTCAGGG + Intergenic
1003614247 6:7641131-7641153 AGCCAGTTCCCCCAGGCTCAGGG + Intergenic
1005318028 6:24623144-24623166 CACCTGTTCTACGTGGCTGAAGG + Intronic
1007201880 6:40116488-40116510 AGCCAGATCCACGTGGTTCAAGG + Intergenic
1014813641 6:125911764-125911786 AATCAGATTCAAGTGGCTCATGG + Intronic
1016354862 6:143207602-143207624 AACTAGTTCCACCTTGCTCCTGG - Intronic
1017368173 6:153669759-153669781 AACGAGTGCCATGTGGCTTATGG - Intergenic
1018841229 6:167518518-167518540 AACCTGTTCCATGTGTCTCCCGG - Intergenic
1019682308 7:2357708-2357730 CATCGGTTACACGTGGCTCATGG - Intronic
1021703930 7:23348107-23348129 AAGCAGTTCAACTTGGCTTATGG - Intronic
1026611555 7:71864478-71864500 ATTCAGTTCCTCGTGGCTCCAGG - Intronic
1029019473 7:97349186-97349208 AACCAGTTCCACTTTGGTCTAGG - Intergenic
1030658794 7:112197029-112197051 AACCAGTTCCACCTGCCTTAGGG + Intronic
1034714505 7:153228727-153228749 ATGCTGTTCCACGTGGCTGAGGG + Intergenic
1041194839 8:55390727-55390749 AACCAGTGCCAGGTGATTCAGGG - Intronic
1042602768 8:70514449-70514471 AATCACTTCCATATGGCTCAAGG + Intergenic
1043082688 8:75785224-75785246 AACCAGCTCCACGCAGCTCACGG + Intergenic
1048030603 8:130628087-130628109 ACACAGTTCCACGTGGCTGGGGG - Intergenic
1051612745 9:18977641-18977663 ATACAATTCCAAGTGGCTCATGG - Intronic
1056900485 9:90594864-90594886 AAACAGTGCCTTGTGGCTCATGG + Intergenic
1057208909 9:93188994-93189016 ACACTGTTCCATGTGGCTCAGGG + Intronic
1057438884 9:95067429-95067451 ACACAGTTCCATGTGGTTCAAGG - Intronic
1059710757 9:116865662-116865684 AACCAGTTCCCTGAGGCTGAAGG + Intronic
1060531229 9:124348042-124348064 AACCAGTGGCACGTGGCCCTTGG + Intronic
1060967220 9:127718002-127718024 CAACAGTTCCACGTGGCTGGTGG - Intronic
1187120548 X:16401764-16401786 AACCAGTTTCACCTGGCCTATGG - Intergenic
1187528525 X:20075497-20075519 AAACAGTCCAACATGGCTCATGG - Intronic
1188452113 X:30318288-30318310 AACCAGAAACATGTGGCTCAAGG - Intergenic
1188542414 X:31265623-31265645 AACCAATTCCACGGTGTTCAAGG + Intronic
1189206671 X:39245753-39245775 AACCTGTTCCACTTTACTCAAGG - Intergenic
1189447416 X:41093663-41093685 AACCAGTTCCCTCTGTCTCAAGG - Intronic
1199978182 X:152906392-152906414 AAGCACTTTCACGTGGCTCTGGG - Intergenic