ID: 923014026

View in Genome Browser
Species Human (GRCh38)
Location 1:230112200-230112222
Sequence AGGACTCATGTGTCTACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923014018_923014026 29 Left 923014018 1:230112148-230112170 CCAGGCCAGGTGGCTGCTTTCTC 0: 1
1: 0
2: 6
3: 36
4: 375
Right 923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 161
923014019_923014026 24 Left 923014019 1:230112153-230112175 CCAGGTGGCTGCTTTCTCCTCTC 0: 1
1: 0
2: 6
3: 61
4: 439
Right 923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 161
923014022_923014026 7 Left 923014022 1:230112170-230112192 CCTCTCTCTGCAGTGGGATTTTC 0: 1
1: 0
2: 3
3: 23
4: 257
Right 923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923014026 Original CRISPR AGGACTCATGTGTCTACCTG TGG Intronic
903283919 1:22265430-22265452 AGGACGTATGTGTATATCTGGGG + Intergenic
904992768 1:34607052-34607074 AGGGCTCAGGAGTCTGCCTGTGG - Intergenic
905977199 1:42184814-42184836 ATGAGTCATGTGTCTAACTGAGG + Intronic
906203186 1:43972790-43972812 TGGACCCATCTGTCTTCCTGAGG + Exonic
907284747 1:53372470-53372492 ATGACTCACCTGTCTGCCTGGGG - Intergenic
907380048 1:54079655-54079677 AGGACTCATGTGACTAGATTGGG + Intronic
913002417 1:114594232-114594254 AGGAGTCATGTGGATATCTGCGG + Intronic
913026671 1:114850177-114850199 GGGAGTCATGTGACTATCTGGGG - Intergenic
913528502 1:119715605-119715627 AGGAAGCATGTGTGAACCTGAGG + Intronic
914931583 1:151939018-151939040 AGGACTCTTGTGACTACATTGGG + Intergenic
916940193 1:169668864-169668886 AGAACTTTTGTGTCTACCTCAGG + Intronic
922266741 1:223991463-223991485 AGGCATAATGTGTCCACCTGTGG - Intergenic
923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG + Intronic
924734214 1:246740350-246740372 AGGCTTCATGTTTCTAACTGTGG + Intronic
1067268970 10:44773286-44773308 AGGACTCATGTGGCTACATGGGG + Intergenic
1067276416 10:44838858-44838880 AGGTCTGAAGTGTCAACCTGGGG - Intergenic
1067730501 10:48807126-48807148 AGGACTGATGAGGCAACCTGGGG - Intronic
1069715546 10:70518835-70518857 GTGACTCATGTGTCTGCCAGGGG - Intronic
1071078813 10:81784860-81784882 AGAACTTTTGTGTCTAGCTGAGG + Intergenic
1074291542 10:112141240-112141262 AGGACCCATGTGTCTGCCTTAGG - Intergenic
1074785311 10:116834218-116834240 AGGGCTCTTGTGGCTGCCTGGGG - Intergenic
1076603122 10:131671923-131671945 AGGACTCATGGGGCCCCCTGAGG - Intergenic
1076881944 10:133243883-133243905 AGGGCTCATGTGTGCACCTGCGG - Intergenic
1077236718 11:1485448-1485470 GGCACTCTTGTGTCTACTTGTGG + Intronic
1077370828 11:2180878-2180900 AGGAGGCATCTGTCTTCCTGAGG - Intergenic
1077949100 11:6935056-6935078 AGTACTGAGGTGGCTACCTGGGG + Intronic
1083322540 11:61856352-61856374 AGGCCACATCTGGCTACCTGAGG - Intronic
1083488111 11:62996136-62996158 TGGACTCTGGTGTCCACCTGGGG + Exonic
1084466600 11:69326816-69326838 AAGTGGCATGTGTCTACCTGGGG - Intronic
1085303721 11:75473515-75473537 AGGCCTCAGGTGTCTATGTGGGG - Intronic
1088597059 11:111448627-111448649 AGGACACGTGTGTCTGCCGGGGG + Intronic
1092015502 12:5155316-5155338 AGGACTATTGTGTCTACCTTCGG - Intergenic
1092134055 12:6133401-6133423 AGAACTTTTGTGTCTACCTCAGG + Intergenic
1096434503 12:51577363-51577385 AGGCCTCATGTGTTAGCCTGTGG - Intergenic
1096762293 12:53851944-53851966 AGGACTCAAGTGCCTCCCTAAGG + Intergenic
1098899913 12:76102009-76102031 AGGAATGATGTATCTGCCTGGGG - Intergenic
1100913254 12:99389272-99389294 GTGCCTCATGTGTTTACCTGGGG - Intronic
1103164161 12:118755967-118755989 ATGAGCCATGTGGCTACCTGGGG + Intergenic
1104105153 12:125652025-125652047 AGGACTCATGTGATTACATTGGG + Intronic
1105833498 13:24187260-24187282 ATGACTCATGTGTCACTCTGAGG - Intronic
1106062882 13:26312106-26312128 AGCACTCTTGTGTCTAGCTACGG + Intronic
1111960785 13:94807781-94807803 AGGACTCATGTGATTAGATGGGG + Intergenic
1113445042 13:110359430-110359452 TGGACTCATGTATCTACCCTAGG + Intronic
1119300210 14:73566000-73566022 AGAACTTTTGTGTCTAGCTGAGG - Intergenic
1122415004 14:101545204-101545226 AGGATGCATCTGTCTACCTTTGG - Intergenic
1123222958 14:106873397-106873419 AGAACTCAGTTCTCTACCTGTGG + Intergenic
1126228153 15:46295412-46295434 ATGAGACATGTGGCTACCTGGGG - Intergenic
1127846706 15:62876893-62876915 AGGCCTCATGTGGCTCCCTCTGG - Intergenic
1127916548 15:63459811-63459833 AGAACTTGTGTGTCTAGCTGAGG + Intergenic
1128359904 15:66954655-66954677 AGGACTCCTATCTGTACCTGTGG - Intergenic
1128373670 15:67059944-67059966 ATGACTGATGTGTGTAACTGAGG - Intergenic
1130162396 15:81414397-81414419 AGAACTTTTGTGTCTACCTAAGG + Intergenic
1133660555 16:7912526-7912548 AGGACCCATGTTTCTGCTTGTGG - Intergenic
1135551211 16:23399586-23399608 AGCACTCATGTGTCTGCAGGGGG - Intronic
1138718036 16:59046717-59046739 AGGGCTCATGTGATTACCTCGGG - Intergenic
1141014700 16:80438026-80438048 AGAGCACATCTGTCTACCTGAGG + Intergenic
1141557226 16:84844198-84844220 AGGAGTCATGTGTGTTCCTGGGG + Intronic
1146173220 17:30648594-30648616 AGGAGTCATGTGGCTGGCTGAGG + Intergenic
1146434809 17:32834513-32834535 AGACCTCTTGAGTCTACCTGAGG + Intronic
1146919817 17:36703086-36703108 AGGAGTCATGTTCCTACCTGAGG + Intergenic
1148757137 17:49979226-49979248 TGTACACATGTGTCTACATGTGG - Intergenic
1151838900 17:76603298-76603320 AGGAATCATGTTTCAACATGAGG + Intergenic
1156460015 18:37316377-37316399 AGGAGTCATCTGTCTGCATGGGG - Intronic
1157141923 18:45117377-45117399 ATGGATCATGTTTCTACCTGAGG - Intergenic
1159452843 18:68624468-68624490 AGGACTCATGTGACTACATTGGG - Intergenic
1163724595 19:18915493-18915515 AGGACGCATGTGTGTCCCCGGGG + Intronic
1164084952 19:21892590-21892612 TGGACTCATGTTTGAACCTGTGG - Intergenic
1164100346 19:22049343-22049365 AGGACTCGTGATTGTACCTGTGG + Intergenic
1164148212 19:22525886-22525908 AGTTCTCATGTTTGTACCTGGGG - Intronic
1164725102 19:30460938-30460960 AGGCATCTTGTTTCTACCTGGGG - Intronic
925103608 2:1270169-1270191 AGGAGTCAGGTCACTACCTGGGG - Intronic
925409886 2:3633864-3633886 AGGAAACATGTGTCTTCCTCGGG - Intronic
926398582 2:12471049-12471071 AGGACTCATATGATTACCTTGGG - Intergenic
927199255 2:20568276-20568298 AGGAGTCCCGTGGCTACCTGGGG + Intronic
927752842 2:25685385-25685407 AGGACTCATGTGTCAGCCTCTGG - Intergenic
929713386 2:44287329-44287351 AGGAACCATGTGACTATCTGGGG + Intronic
930608155 2:53513697-53513719 ATGACTCAGTTTTCTACCTGTGG - Intergenic
931167102 2:59760010-59760032 ATTATTCATGTGTCTATCTGTGG + Intergenic
931277938 2:60760606-60760628 GGGAGCCATGTGTCTATCTGAGG + Intronic
932317534 2:70795894-70795916 AAGACTGCTCTGTCTACCTGGGG + Intergenic
932808140 2:74800301-74800323 AGGAGCCATATGTGTACCTGGGG + Intergenic
933152444 2:78931710-78931732 AGGGCTCATGTGAGTACCTCAGG - Intergenic
933840101 2:86279603-86279625 AGGATTCATGTGATTACATGGGG - Intronic
935445438 2:103151438-103151460 AGGACTCATGTGATTACATCGGG - Intergenic
936073985 2:109390090-109390112 AGGATTTAAGTGTCTACCGGAGG + Intronic
936467214 2:112764384-112764406 AGGACCCAGACGTCTACCTGGGG + Intronic
936687358 2:114843292-114843314 ATTACTCATGTTTCTACCAGTGG + Intronic
937527800 2:122792180-122792202 GTGACTCATGTGTAGACCTGTGG - Intergenic
940270144 2:151881658-151881680 AGGAATCTTGTGTCTCACTGTGG - Intronic
940480702 2:154227293-154227315 AGGACTCCACTGGCTACCTGGGG + Intronic
943882056 2:193158242-193158264 AGGACTCATGTGATTATCTTGGG + Intergenic
944681971 2:202085376-202085398 AGGACTCTTGTGCTTACCTTGGG - Intronic
945115361 2:206403070-206403092 CTGACTCATGGTTCTACCTGAGG - Intergenic
946702467 2:222426320-222426342 GCAACTCACGTGTCTACCTGTGG - Intronic
948833957 2:240615290-240615312 GGGACTCACGGGTCTACATGAGG - Intronic
1170045824 20:12084469-12084491 CAGACACATGTGTCTACTTGGGG - Intergenic
1170772818 20:19348909-19348931 AGTATTCAGGTGTTTACCTGAGG - Intronic
1175945866 20:62558479-62558501 AGGCCTCCTGTGTCTACCCCAGG + Intronic
1180536723 22:16399087-16399109 AAGACTAATTTGTGTACCTGAGG + Intergenic
1181011684 22:20044579-20044601 AGGACTCCTGTGTAGGCCTGTGG + Intronic
1182780871 22:32866458-32866480 AAAACTCATGTGCTTACCTGCGG - Intronic
1183406128 22:37631501-37631523 AGGCCTCATGTGTCTGCTTGGGG - Intronic
1184074474 22:42167407-42167429 AGGACTTCTGTGTCGACCTCAGG - Intronic
1184816046 22:46871160-46871182 AGGACTCATCTCTCTACTTAAGG - Intronic
1185074340 22:48675305-48675327 AGGACTCAGGAGGCTTCCTGTGG + Intronic
949598338 3:5571998-5572020 AGAACTCATGGTTCTCCCTGAGG - Intergenic
950208001 3:11094721-11094743 AGAACTTTTGTGTCTAGCTGAGG + Intergenic
954180981 3:48881178-48881200 AGGGCTCATGCATCTACCTCAGG + Intronic
954385545 3:50242028-50242050 AGGACCTGTGTGTCTGCCTGTGG - Intronic
956183827 3:66544201-66544223 AGAACTTGTGTGTCTACCTCAGG - Intergenic
960503867 3:118469924-118469946 AGGACTGCTGTGTCTTCATGTGG + Intergenic
961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG + Intronic
961826092 3:129599844-129599866 AGGACTCCTGCTTCTATCTGCGG + Intronic
964971886 3:162574472-162574494 AGAACTTTTGTGTCTAGCTGAGG + Intergenic
966329577 3:178795460-178795482 AGGACTCATGTGGTTACCCTGGG - Intronic
967575839 3:191091165-191091187 AGGACTCCTGTATATATCTGGGG + Intergenic
969950568 4:10831218-10831240 AGGTGTCCTGTGTCAACCTGAGG - Intergenic
970576766 4:17436323-17436345 AGAACTTTTGTGTCTAGCTGAGG - Intergenic
971183772 4:24354221-24354243 AGGACTCATGTGATTACATTGGG + Intergenic
972285148 4:37641275-37641297 GGGACGCATGTGTGTACATGTGG - Intronic
973048695 4:45567816-45567838 AGAACTTATGTGTCTAGCTCAGG + Intergenic
973704855 4:53571369-53571391 AGAACTCATGTGATTACCTTGGG - Intronic
975964413 4:79953057-79953079 AGGACTGAGGTGTCTACCACAGG + Intronic
977805964 4:101298196-101298218 GGGACTCTTGAGTCTATCTGAGG - Intronic
983290564 4:165798994-165799016 AGAACTTTTGTGTCTAGCTGGGG - Intergenic
983801597 4:171937031-171937053 TGGACTCATGTGCTTAGCTGTGG + Intronic
990988825 5:61665445-61665467 TGGAATTATGTTTCTACCTGAGG - Intronic
992466031 5:77005769-77005791 AGGACTCATGTGATTACATGAGG - Intergenic
994694883 5:103061659-103061681 AGGAGCCATGTGTATACCTGGGG - Intergenic
996047664 5:118893634-118893656 AGGACTCATGTGACTAGATTGGG - Intronic
1000691414 5:164326371-164326393 AAGGCTCATTTGGCTACCTGAGG - Intergenic
1001981834 5:176043520-176043542 TGGAGTCAAGTGTCCACCTGGGG + Intergenic
1002336135 5:178479510-178479532 AGGAGCCATGTGTCTTCCTGGGG - Intronic
1002933554 6:1651731-1651753 AGGGCTCATGGGTCTATCTAAGG - Intronic
1003193852 6:3897745-3897767 AGAACTTGTGTTTCTACCTGGGG - Intergenic
1003400224 6:5784758-5784780 AGGCCGCATGTGGCTCCCTGTGG + Intergenic
1008765514 6:54908842-54908864 AGGACAAATGGGTATACCTGAGG - Intronic
1010328806 6:74597041-74597063 AGGCCACATGTGCCTACCTATGG + Intergenic
1016443706 6:144110540-144110562 AGGACTCAGGTGTCCATCTTTGG + Intergenic
1017924780 6:158901463-158901485 AGGACTCATCTGTCAGCTTGTGG + Intronic
1018340661 6:162847656-162847678 AGGACACATGTGTTCACCTCGGG - Intronic
1018483732 6:164218039-164218061 AGGACCCATTTATCTTCCTGCGG - Intergenic
1020758991 7:12244324-12244346 AGGACTTATGTGGCCACCAGAGG - Intergenic
1021400139 7:20200721-20200743 AGCACCCATGTTTCTAGCTGGGG - Intronic
1023742899 7:43296536-43296558 AGGGCTCATGTTTCAACTTGAGG - Intronic
1025716751 7:63964499-63964521 AGGACTCTTGTGATTACCTGAGG + Intergenic
1025786550 7:64649245-64649267 AGGACCCATGACTGTACCTGCGG - Intergenic
1026850684 7:73721438-73721460 AGGACTCATGGGAAAACCTGTGG + Intergenic
1028218348 7:88163096-88163118 AGAACACAGGTGTCTTCCTGTGG + Exonic
1030555975 7:111024325-111024347 AGGACTCAGCTGACTACTTGAGG + Intronic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1033795903 7:144844329-144844351 AAGACACATGTGCCTACTTGAGG + Intergenic
1035196248 7:157223093-157223115 ATGGCTCATGGGTCTGCCTGAGG + Intronic
1036085269 8:5606899-5606921 AGGGCTCCTGTGATTACCTGGGG + Intergenic
1036206285 8:6807670-6807692 AGAACTCATGCCTCTGCCTGTGG - Intergenic
1037024866 8:14022601-14022623 AGGACTCAGGTTTCTTACTGGGG - Intergenic
1039046409 8:33454414-33454436 AGAACTCATGTGATTACATGGGG + Intronic
1042058477 8:64791437-64791459 AGGACTCTTGTGATTACCTCGGG - Intronic
1043850942 8:85215907-85215929 AGGACTCAACTCTCAACCTGTGG + Intronic
1046048150 8:108987557-108987579 AGGACTTCTGTGTCTCCTTGTGG - Intergenic
1047100076 8:121667042-121667064 AGAACTCTTGTGTCTAGCTCAGG - Intergenic
1048608065 8:135990711-135990733 TGGACTGAGGTGTCTACATGAGG + Intergenic
1049457821 8:142702761-142702783 GGGAGTCATGTGTCTGTCTGTGG + Intronic
1049576761 8:143393268-143393290 AGGTCTCATGTGGGTATCTGGGG + Intergenic
1049927454 9:423355-423377 GGGACTCATTAGGCTACCTGTGG - Intronic
1053064873 9:35060974-35060996 AGCACGTATGTGTGTACCTGAGG + Intronic
1054155279 9:61635359-61635381 AGGCCAGATGTGTCTCCCTGGGG - Intergenic
1054178200 9:61891087-61891109 AGGCCAGATGTGTCTCCCTGGGG + Intergenic
1054475068 9:65566467-65566489 AGGCCAGATGTGTCTCCCTGGGG - Intergenic
1054659329 9:67689737-67689759 AGGCCAGATGTGTCTCCCTGGGG - Intergenic
1058556783 9:106177236-106177258 ATGACTGATGTTTCTATCTGTGG - Intergenic
1061312744 9:129774817-129774839 AGGGGACATGTGTCTACCTCGGG - Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1187348620 X:18490481-18490503 AAGATTCATGTGCCTACCTGAGG - Intronic
1193856111 X:86604720-86604742 AGGACTCATGTGATTACATTGGG - Intronic
1200006545 X:153088945-153088967 AGTACTCATGTGTACACCTAGGG + Intergenic
1200305103 X:155017044-155017066 AGGACTCATGTGATTACATTGGG - Intronic