ID: 923015128

View in Genome Browser
Species Human (GRCh38)
Location 1:230120645-230120667
Sequence GACGCACAGCTCCCCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5095
Summary {0: 1, 1: 0, 2: 20, 3: 436, 4: 4638}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923015125_923015128 -9 Left 923015125 1:230120631-230120653 CCGCAGGACTCAGGGACGCACAG 0: 1
1: 0
2: 1
3: 30
4: 263
Right 923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG 0: 1
1: 0
2: 20
3: 436
4: 4638
923015118_923015128 8 Left 923015118 1:230120614-230120636 CCGATCTGCCCTTCCTTCCGCAG 0: 1
1: 0
2: 0
3: 30
4: 271
Right 923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG 0: 1
1: 0
2: 20
3: 436
4: 4638
923015122_923015128 -1 Left 923015122 1:230120623-230120645 CCTTCCTTCCGCAGGACTCAGGG 0: 1
1: 0
2: 2
3: 13
4: 208
Right 923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG 0: 1
1: 0
2: 20
3: 436
4: 4638
923015120_923015128 0 Left 923015120 1:230120622-230120644 CCCTTCCTTCCGCAGGACTCAGG 0: 1
1: 0
2: 2
3: 29
4: 231
Right 923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG 0: 1
1: 0
2: 20
3: 436
4: 4638
923015124_923015128 -5 Left 923015124 1:230120627-230120649 CCTTCCGCAGGACTCAGGGACGC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 923015128 1:230120645-230120667 GACGCACAGCTCCCCAGGGCTGG 0: 1
1: 0
2: 20
3: 436
4: 4638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923015128 Original CRISPR GACGCACAGCTCCCCAGGGC TGG Intronic
Too many off-targets to display for this crispr