ID: 923017229

View in Genome Browser
Species Human (GRCh38)
Location 1:230136335-230136357
Sequence CAGGGTTATCAGAGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923017229_923017240 14 Left 923017229 1:230136335-230136357 CCAGCCATCCTCTGATAACCCTG 0: 1
1: 0
2: 3
3: 20
4: 187
Right 923017240 1:230136372-230136394 GAGAGAGTGGGGCCTGTTCCTGG 0: 1
1: 0
2: 2
3: 34
4: 297
923017229_923017236 1 Left 923017229 1:230136335-230136357 CCAGCCATCCTCTGATAACCCTG 0: 1
1: 0
2: 3
3: 20
4: 187
Right 923017236 1:230136359-230136381 CATAGAGCTCCAGGAGAGAGTGG 0: 1
1: 0
2: 3
3: 31
4: 305
923017229_923017237 2 Left 923017229 1:230136335-230136357 CCAGCCATCCTCTGATAACCCTG 0: 1
1: 0
2: 3
3: 20
4: 187
Right 923017237 1:230136360-230136382 ATAGAGCTCCAGGAGAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 214
923017229_923017232 -8 Left 923017229 1:230136335-230136357 CCAGCCATCCTCTGATAACCCTG 0: 1
1: 0
2: 3
3: 20
4: 187
Right 923017232 1:230136350-230136372 TAACCCTGCCATAGAGCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
923017229_923017238 3 Left 923017229 1:230136335-230136357 CCAGCCATCCTCTGATAACCCTG 0: 1
1: 0
2: 3
3: 20
4: 187
Right 923017238 1:230136361-230136383 TAGAGCTCCAGGAGAGAGTGGGG 0: 1
1: 0
2: 2
3: 27
4: 323
923017229_923017241 17 Left 923017229 1:230136335-230136357 CCAGCCATCCTCTGATAACCCTG 0: 1
1: 0
2: 3
3: 20
4: 187
Right 923017241 1:230136375-230136397 AGAGTGGGGCCTGTTCCTGGTGG 0: 1
1: 0
2: 0
3: 44
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923017229 Original CRISPR CAGGGTTATCAGAGGATGGC TGG (reversed) Intronic
901419385 1:9140221-9140243 CAGGGTTACCAGGGGCTGGGGGG - Intergenic
902045643 1:13521958-13521980 CAGGGTTATCTAATGATGGGAGG + Intergenic
902593792 1:17494241-17494263 AAGGGTTATCAGCAGAGGGCTGG - Intergenic
904550761 1:31315407-31315429 CATGCTTCTCAGAGGATGACAGG - Intronic
904596684 1:31650940-31650962 CAGGGTTAACTGAGAATAGCTGG + Intergenic
904855733 1:33497021-33497043 TAGTGTCATAAGAGGATGGCAGG - Intergenic
906150726 1:43585966-43585988 CAGAATTAGCAGAGGCTGGCAGG - Intronic
906151114 1:43588276-43588298 GAGGGTCCTCAGAGCATGGCTGG - Intronic
906281370 1:44556454-44556476 CAGGTTTACCAGAGGACAGCAGG - Intronic
913283671 1:117208853-117208875 CTGGGTCTGCAGAGGATGGCAGG + Intronic
913327560 1:117639926-117639948 CTGGTTTTTCAGGGGATGGCAGG - Intergenic
915382959 1:155459872-155459894 AGGGTTTATCAGAGGTTGGCTGG + Exonic
915504981 1:156348970-156348992 AAAGGTAATCAGAGGATGACTGG + Intronic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
920583533 1:207135795-207135817 CAGTGTTTTCACAGGTTGGCAGG + Intronic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923017229 1:230136335-230136357 CAGGGTTATCAGAGGATGGCTGG - Intronic
924037022 1:239948280-239948302 GAGGCCTATCAGAGGGTGGCAGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063195077 10:3734391-3734413 CAGGTCTTGCAGAGGATGGCTGG + Intergenic
1068631156 10:59298938-59298960 TAGGGTTACCAGAGGCTGGTGGG + Intronic
1070641161 10:78171094-78171116 TAGAGGTATCAGAGGAGGGCAGG + Intergenic
1070957367 10:80473379-80473401 CAGGGTTTTTACAGGATGCCAGG + Intronic
1071977269 10:90967669-90967691 CAAGGTGATTAGAGGATGGGGGG - Intergenic
1072006748 10:91258115-91258137 TAGGGTTGTCAGGGGATGGGAGG + Intronic
1072624381 10:97101637-97101659 CACAGCTATCAGAGGAGGGCAGG - Intronic
1073055518 10:100698302-100698324 CAGGGTGATCGGAGGATGGAGGG - Intergenic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1074724756 10:116296654-116296676 CTGGGTAATAAGAGGATGGCCGG - Intergenic
1076484194 10:130805253-130805275 CAGGTTTATCAGAGGAAGCTAGG - Intergenic
1079079137 11:17401828-17401850 CAGGGTAGTGAGACGATGGCAGG + Intronic
1081017988 11:37907067-37907089 CAGGCTCATAAGAGCATGGCCGG - Intergenic
1081160397 11:39741914-39741936 GATGGTTATCAGAGGCTGGAAGG + Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1085181730 11:74542247-74542269 CAGGTTTATGAGAGCATGGTAGG + Intronic
1085320668 11:75572089-75572111 CAGGGTGCACACAGGATGGCAGG + Exonic
1085339130 11:75719940-75719962 CAGGGGTCTGAGAGGAAGGCAGG - Intronic
1086339906 11:85838155-85838177 CAGGTTTGTCAGAGGTTGACAGG - Intergenic
1087955571 11:104282804-104282826 AATGGTTACCAGAGGATGGCAGG - Intergenic
1090612818 11:128486850-128486872 CAGGGTAATTAGAGGATCCCAGG - Intronic
1093497166 12:19771595-19771617 CAGGGTTCTCAGACTATAGCAGG - Intergenic
1094061594 12:26320036-26320058 CTGGGTTATAATAGCATGGCTGG + Intergenic
1094473651 12:30825179-30825201 CAGGGCTATAGAAGGATGGCTGG - Intergenic
1094801388 12:34039614-34039636 CACAGCTATCAGAGAATGGCAGG - Intergenic
1095114518 12:38335614-38335636 CACAGCTATCAGAGAATGGCAGG - Intergenic
1096564088 12:52461778-52461800 CAGGTTTCTCAGGTGATGGCTGG - Intergenic
1097149418 12:56965437-56965459 CAGAGTAATTAGAGGTTGGCAGG - Intergenic
1099036229 12:77590500-77590522 TGGGGTTATCAGAGGGTGGAGGG + Intergenic
1101176930 12:102161809-102161831 CAGAGTTATCACAGGATGGCAGG + Intronic
1102609068 12:114095349-114095371 CAGGTTTCTCAGAGGAAGGTGGG + Intergenic
1102827893 12:115965709-115965731 CAGGGGAAGAAGAGGATGGCTGG + Intronic
1104065648 12:125303157-125303179 TGAGGTTATCAGAGGCTGGCAGG - Intronic
1104577147 12:129977874-129977896 CAGGGCCATCAGAAGATTGCTGG - Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1106724542 13:32470631-32470653 CAGGCTAATGAGAGCATGGCAGG + Intronic
1107686878 13:42909753-42909775 CATGGTTACCAGAGGCTGGGGGG + Intronic
1107708848 13:43133024-43133046 CAGAGAGATCACAGGATGGCTGG - Intergenic
1110047275 13:70845848-70845870 CATGGTTATCAAAGGCTGGGTGG - Intergenic
1111192661 13:84830774-84830796 CAGGGCTGTCAGAGGCTGGAGGG + Intergenic
1112685411 13:101819377-101819399 CCGGGTTATCACAGGATCTCTGG - Intronic
1118095053 14:62527026-62527048 TGGGCTTATCAGAGGATGGAGGG + Intergenic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1118818048 14:69326546-69326568 CATGGATATCAGAGGAGAGCTGG + Intronic
1119266838 14:73267746-73267768 CAGGCTGATCAGGGGATGGCTGG - Intronic
1119402091 14:74369762-74369784 CTGGGTTGTGAGAAGATGGCAGG + Intergenic
1120138864 14:80904316-80904338 AATGGTTACCAGAGGGTGGCGGG + Intronic
1123449343 15:20350281-20350303 CAGGGTGACCAGATGCTGGCCGG - Intergenic
1126954092 15:53913513-53913535 CAGGCTCATAAGAGCATGGCAGG + Intergenic
1129169695 15:73800070-73800092 CAGGGAGCTCAGAGCATGGCAGG - Intergenic
1130418223 15:83714511-83714533 AAGGGTTAGACGAGGATGGCAGG - Intronic
1130617341 15:85423749-85423771 CAGATTCATCAGAGGATGGATGG + Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131307927 15:91261863-91261885 CTGGTTTGTCAGAGCATGGCAGG - Intronic
1132215487 15:100058723-100058745 TCCGGTGATCAGAGGATGGCAGG - Intronic
1133346698 16:5075910-5075932 CAGGCAGATCAGAGGAAGGCAGG - Intronic
1135838575 16:25851892-25851914 CATTGTTATCATAGCATGGCAGG - Intronic
1136370617 16:29833881-29833903 CAGGGCTATGACAGGAAGGCAGG - Intronic
1136581200 16:31152022-31152044 GGGGGTGATCAGAGGATGGGAGG - Intergenic
1137298531 16:47122193-47122215 CATGAGTAGCAGAGGATGGCAGG + Intronic
1138746983 16:59375228-59375250 CAGGGTTATCAAAGGAGGCCAGG - Intergenic
1141051923 16:80774375-80774397 GGGGGTTATCAGAGAATGGGTGG + Intronic
1141742867 16:85905646-85905668 CAGGCCTCTCAGAGGATGGATGG - Intronic
1142048737 16:87943892-87943914 GAGGGTTCTCAGAGAATGGTGGG - Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1144444522 17:15314711-15314733 CAAGGTTACCAATGGATGGCAGG - Intronic
1146311984 17:31776396-31776418 TAGTGTGATCAGAGGATGGAAGG - Intergenic
1148091002 17:45022385-45022407 CAGGAATGTCAGAGCATGGCAGG - Intergenic
1148398607 17:47332579-47332601 GATGGTTATCAGAGGCTGGGGGG - Intronic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1151945428 17:77317193-77317215 CAGAGCTGTGAGAGGATGGCTGG - Intronic
1154503074 18:15005989-15006011 CAGGGGTCACAGAGGATGGTGGG + Intergenic
1155157746 18:23171677-23171699 GAGGGTTATCAGAGGGTGGCAGG - Intronic
1160696146 19:485551-485573 AAGGGTGATCAGAGAATGGTGGG + Intergenic
1162158173 19:8694052-8694074 CAGGGTTAGGGGCGGATGGCAGG + Intergenic
1163325758 19:16602034-16602056 CAGGGGTGTCAGGGGATGGATGG + Intronic
1165291602 19:34890328-34890350 AAGGGTTTTCAGGGGCTGGCAGG - Intergenic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1167374190 19:49102435-49102457 CCGGGTCATCAGAGGCTGGGTGG - Intronic
1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG + Intergenic
930917846 2:56715692-56715714 CAGGATTGTCAGAGGTTGTCAGG - Intergenic
931167265 2:59761526-59761548 CAGGGTGATCAGAGGATTCCTGG + Intergenic
931756534 2:65379601-65379623 CAGGGTTGTCATAGGAGGGAAGG - Intronic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
932891905 2:75604835-75604857 CAGAGTTGTCAGAGGATGGCAGG - Intergenic
932934483 2:76086218-76086240 CAGGGGAATCAGAAGATGTCTGG + Intergenic
933858304 2:86440852-86440874 CAGGGTTAGCGGGGGAGGGCAGG - Exonic
934046459 2:88176575-88176597 CAGGATTATCACAGGAAGCCAGG - Intronic
936260928 2:110959165-110959187 GAGGGTTAATTGAGGATGGCAGG + Intronic
938565717 2:132516601-132516623 GAAGGTTATCAGAGTGTGGCCGG - Intronic
939057532 2:137382566-137382588 CAGGCTTGTGAGAGTATGGCAGG + Intronic
939983763 2:148811122-148811144 CAGGGAACCCAGAGGATGGCAGG - Intergenic
940503205 2:154520561-154520583 AATGGTTATCAGAGGCTGGGAGG - Intergenic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
941485064 2:166069957-166069979 CTGGGTTATCTGAGATTGGCTGG - Intronic
941725630 2:168857324-168857346 CAGGGTTATCGGAGAATAACAGG + Intronic
942889943 2:180977716-180977738 CAGGGTTGTGAGAGGCTGGCAGG + Intronic
946168838 2:217881566-217881588 CTGGGTTTTCTGTGGATGGCTGG - Intronic
946197607 2:218044594-218044616 GGGGTTTATCAGAGGATGGAGGG - Intronic
946507501 2:220317480-220317502 CAGGGTTAACAGTAGATGGTCGG - Intergenic
948422853 2:237871140-237871162 CAGAGGTGTCAGTGGATGGCGGG + Intronic
1168788177 20:557549-557571 CAGGGTTACGTGAGGATGGTGGG - Intergenic
1170035071 20:11981462-11981484 GAGGGTTAGTTGAGGATGGCTGG - Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173178825 20:40786324-40786346 CAAGGCTATCAGAGGATGGTAGG - Intergenic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174339287 20:49886072-49886094 CAGGGAGGGCAGAGGATGGCCGG - Intronic
1175977929 20:62722434-62722456 AAGGCTTATCAGAGGGTGGCTGG - Intronic
1177751172 21:25285809-25285831 CAGGGTTACAAGATGATGACTGG - Intergenic
1180591881 22:16946219-16946241 CAGGGTTGTCAGGGGATGCTAGG + Intergenic
1181331389 22:22094848-22094870 CATGGTTACCAGAGGTTGGGGGG + Intergenic
1182992226 22:34778921-34778943 GGGGCTTATCAGAGGATGGAGGG + Intergenic
949599261 3:5580694-5580716 CAGAGATATCAGAGAATGGATGG - Intergenic
949711662 3:6877478-6877500 CAGGAGTAGCAGGGGATGGCAGG - Intronic
949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG + Intronic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
955841215 3:63114980-63115002 CAGGGTTATCAGCTGGTGACTGG - Intergenic
957681374 3:83440111-83440133 CAGGGCTATCAGATGGTAGCAGG - Intergenic
960939767 3:122925975-122925997 CAGGGTTACCAGAAGACTGCTGG + Intronic
963040592 3:141066822-141066844 CAGGGCTTTCAGAGGCTGCCAGG + Intronic
964030453 3:152132618-152132640 AGAGGTTAGCAGAGGATGGCTGG - Intergenic
966863275 3:184242243-184242265 CAGGGAGCTCAGAGGATGGAGGG - Exonic
970439930 4:16071891-16071913 CAGGGTGATCAGAGGAAGTTAGG - Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
973098048 4:46226733-46226755 AATAGTTATCTGAGGATGGCAGG - Intergenic
982240166 4:153292243-153292265 CTGGCTTAACAGAAGATGGCTGG - Intronic
982291786 4:153789153-153789175 AAGGGTAATCCGAGGAGGGCTGG + Intergenic
983400959 4:167264987-167265009 CAGGGTTTTTAGAGGAGGGAAGG - Intergenic
990825154 5:59891726-59891748 CAGGGTTATGATAGTTTGGCTGG + Intronic
994106312 5:95953087-95953109 CGGGCTGAGCAGAGGATGGCAGG + Intronic
994227379 5:97268526-97268548 GAGGCCTATCAGAGGATGGAGGG - Intergenic
995468773 5:112478614-112478636 CAGGGTTAGAGGAGGTTGGCAGG + Intergenic
1005819571 6:29586791-29586813 CATGGAGCTCAGAGGATGGCAGG - Intronic
1005886675 6:30102456-30102478 CGGGGGTATCAGAGGAAGGTAGG - Intergenic
1005999811 6:30955977-30955999 CAGGGTGATCGGAGGATCACAGG - Intergenic
1007207140 6:40162007-40162029 CAGGGTTCCCAAAGTATGGCTGG - Intergenic
1007703286 6:43776612-43776634 CGGGGTTATCAGTGGCTGGCAGG + Intronic
1009932045 6:70188072-70188094 CAGGGTGATCAGGGGATTCCAGG + Exonic
1011025187 6:82860963-82860985 CAGGCTCATCAGAAGATGGAAGG + Intergenic
1011128917 6:84034353-84034375 CAGGGTTCTCAGATGATGCCTGG + Intronic
1011205040 6:84883251-84883273 CAGGGCTGTCATCGGATGGCTGG + Intergenic
1011967234 6:93174165-93174187 AAGGGATCTCAGAGGCTGGCGGG + Intergenic
1013520751 6:110931106-110931128 CAAAGTTATCAGGGGCTGGCCGG + Intergenic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1015388641 6:132654989-132655011 CTGGGCTGTCAGAGGATGTCAGG - Intergenic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1016894185 6:149036407-149036429 AAGGATTATCAGTGGAAGGCAGG - Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1018733053 6:166667867-166667889 CAGGGGTTTCAGAGTCTGGCAGG - Intronic
1020975054 7:14995717-14995739 CAGAGTTATCAGTGAATGGATGG - Intergenic
1024565011 7:50673645-50673667 CAGGGTTGGCAGAGCATGGCCGG - Intronic
1026000519 7:66556916-66556938 CAGGGTTTGGAGATGATGGCGGG + Intergenic
1026496123 7:70904951-70904973 CAGGGTTATGTGAGCATTGCAGG - Intergenic
1026605296 7:71810762-71810784 CAGGGTTGACAGCAGATGGCTGG - Intronic
1027367622 7:77474451-77474473 CAGGGTTATCACTGGCTGGTTGG + Intergenic
1028276396 7:88863203-88863225 CAGGGGTATCAGAGCATTGTAGG - Intronic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1030676224 7:112388678-112388700 CATGGTTACCAGGGGATGGAGGG + Intergenic
1034165434 7:149021764-149021786 CAGGGTTTGCAGAGCAAGGCAGG - Intronic
1034397481 7:150838233-150838255 CAGGGCCATCAGTGGATGGCAGG + Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036562654 8:9910075-9910097 CAGGGTCACAAGAGGTTGGCTGG - Intergenic
1037255922 8:16953525-16953547 GATGGTTATCAGAGGCTGGCTGG + Intergenic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1041063320 8:54057644-54057666 TATGGTTATCAGAGGCTGGAAGG + Intronic
1041611163 8:59851177-59851199 CATGATTATCAGAGGCTGGGTGG - Intergenic
1041780734 8:61576023-61576045 CAAGGTGATCAGGGGATGGTAGG - Intronic
1045004208 8:97903123-97903145 CAGGGTTGTCAGAAAATGGCTGG - Intronic
1046988236 8:120415758-120415780 CAGGGCAAGCAGAGGATGCCTGG + Intronic
1047339232 8:123964402-123964424 CTGGGTTGTGACAGGATGGCAGG + Intronic
1051259766 9:15251576-15251598 CTGGGTTATGAGATTATGGCTGG - Intronic
1052963400 9:34319661-34319683 CAGGGTGCACACAGGATGGCAGG + Intronic
1053139436 9:35673621-35673643 CAGGGTTAGCTGAGGCTGGCTGG + Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055782940 9:79839666-79839688 CAGGGTTTTCTGTGGTTGGCAGG + Intergenic
1203759698 EBV:5757-5779 CAGAGTTTTCTGAGGAGGGCTGG - Intergenic
1188534962 X:31186489-31186511 GTGGCTTATCAGAGGATGGAGGG + Intronic
1188550992 X:31364398-31364420 GAGGGTGTTAAGAGGATGGCAGG + Intronic
1190421046 X:50284811-50284833 CAGCGTTCACAGAGGATGGTAGG + Intronic
1191645091 X:63471290-63471312 CAGGGTGATCAGAGGTTCTCTGG + Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192595626 X:72405132-72405154 GGGGCTTATCAGAGGATGGAGGG - Intronic
1192928749 X:75782923-75782945 CACTGTTCTCAGAGCATGGCAGG + Intergenic
1196025588 X:111038369-111038391 CCAGGTGAGCAGAGGATGGCAGG - Intronic
1198614994 X:138447314-138447336 CATGGTTATCAGAGGCTGGTGGG - Intergenic
1201315814 Y:12644249-12644271 AAGGGCTATCAGATGAGGGCGGG - Intergenic
1202103695 Y:21339084-21339106 CATGGTTATCAGGGTATGTCTGG + Intergenic