ID: 923018956

View in Genome Browser
Species Human (GRCh38)
Location 1:230148210-230148232
Sequence GGCCACTGATCTGGTTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923018956_923018964 20 Left 923018956 1:230148210-230148232 CCGGCACAACCAGATCAGTGGCC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 923018964 1:230148253-230148275 CACTCAGAGGGAGAGCCCTGTGG 0: 1
1: 0
2: 5
3: 19
4: 287
923018956_923018963 8 Left 923018956 1:230148210-230148232 CCGGCACAACCAGATCAGTGGCC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 923018963 1:230148241-230148263 GCGTGCACAGTGCACTCAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 82
923018956_923018962 7 Left 923018956 1:230148210-230148232 CCGGCACAACCAGATCAGTGGCC 0: 1
1: 0
2: 1
3: 9
4: 134
Right 923018962 1:230148240-230148262 GGCGTGCACAGTGCACTCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923018956 Original CRISPR GGCCACTGATCTGGTTGTGC CGG (reversed) Intronic
905404136 1:37721879-37721901 GGCCACTGCCCTGGCTGAGCTGG + Intronic
907118239 1:51988526-51988548 GGCCACTGATGTTATTCTGCAGG - Intronic
907240541 1:53078671-53078693 TGCCTGTGATCTGGTTGTGCAGG - Exonic
916172342 1:162010527-162010549 GTCTACACATCTGGTTGTGCTGG - Intronic
918041774 1:180918025-180918047 GTCCACTGGTCTGCTGGTGCAGG - Intronic
919880461 1:201897439-201897461 CTCCACTGACCTGGTTGTCCAGG - Exonic
922481828 1:225944719-225944741 GGCCCCTGTTCTGGTTTAGCAGG + Intergenic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
923907692 1:238403611-238403633 TCCTACTGATCTGGTTTTGCAGG + Intergenic
924090764 1:240498618-240498640 GGCCGCTGACATGCTTGTGCAGG - Intronic
1064170626 10:13029035-13029057 GGCCACTAAACAGGGTGTGCAGG + Intronic
1064856033 10:19768028-19768050 GGTCGCTTATCTGGTTGTGATGG + Intronic
1067004320 10:42646667-42646689 GGGAACTGATCAGGTTGTCCAGG - Intergenic
1069546179 10:69330504-69330526 GACCACCGTTCTGGTTCTGCAGG - Intronic
1069784836 10:70981330-70981352 GGCCACTCCTCTGGTCCTGCAGG - Intergenic
1077719184 11:4609801-4609823 AGCCACTCATCTTGTTGTCCTGG - Intergenic
1080572394 11:33568107-33568129 GGGCAAAGCTCTGGTTGTGCAGG - Exonic
1080827882 11:35862979-35863001 GGCCTCTGATCTAGCTATGCTGG + Intergenic
1085323817 11:75591619-75591641 GGCACCAGATTTGGTTGTGCAGG - Intronic
1085707426 11:78799186-78799208 GGCCACTGACCTAGTTGTTTGGG + Intronic
1085738649 11:79061079-79061101 GGCCACATATCTAGTTGAGCTGG - Intronic
1091890671 12:4051730-4051752 GGCCAATGCTGTGGTTGTGGTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1097108085 12:56636816-56636838 AGCCCCTGAGCTGCTTGTGCTGG - Intronic
1097173935 12:57132098-57132120 GGCCCCTGACTTGGTAGTGCTGG + Intronic
1102193790 12:111009471-111009493 GGCCAGTGATATGGTTTGGCTGG - Intergenic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1104962395 12:132494416-132494438 GGCCACAGAACAGGTTGTGCCGG + Intronic
1107262758 13:38514807-38514829 AGCACCTGACCTGGTTGTGCAGG + Intergenic
1108229082 13:48318757-48318779 GGCCACTGGTCTGGCTGTTGGGG + Intronic
1110595820 13:77319386-77319408 GGTCAGTGTTCTGGTTGGGCAGG - Intronic
1111009677 13:82294390-82294412 GGTCACATATCTGGTTGTGATGG + Intergenic
1112349983 13:98624889-98624911 GTCCAGTGATCTGGGAGTGCTGG - Intergenic
1113185375 13:107681370-107681392 GGTCACTGGTCTGGTGGAGCTGG + Intronic
1113709677 13:112455097-112455119 GCCCACTGAGCTGGGGGTGCAGG + Intergenic
1114737444 14:25057078-25057100 GGCCACACATCTGGCTGTGCAGG - Intergenic
1122920011 14:104876146-104876168 GGCCACTGCTGGTGTTGTGCTGG + Intronic
1124476946 15:30043471-30043493 GACCACTGACCTGGCTTTGCTGG - Intergenic
1126043383 15:44614854-44614876 GGCCACAGATATGATTCTGCGGG + Intronic
1127701315 15:61504328-61504350 GGCCTCAGATATGGTTCTGCTGG + Intergenic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1129650907 15:77488138-77488160 TCCCACTGATCTGGTGTTGCAGG - Intergenic
1132406274 15:101543316-101543338 GCCCACTGAGCTGGTTCTGGAGG + Intergenic
1132481052 16:166246-166268 GGTCACTGACCTGGTCCTGCAGG + Exonic
1138446455 16:57067194-57067216 GGCAGCTGGTATGGTTGTGCAGG - Intronic
1139953341 16:70682165-70682187 GGACACTGGTTTGGTTGGGCTGG - Intronic
1141589922 16:85061675-85061697 AGCCACAGCTCTGGTTGTTCCGG + Intronic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1144250077 17:13407565-13407587 GCCAACTGACCTGGTTTTGCCGG - Intergenic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1147692121 17:42322614-42322636 GGCCACTGAACAGGGTGTTCAGG - Intronic
1150233579 17:63573925-63573947 GGCCACACATCTGGTAGTGCTGG - Intronic
1150352788 17:64458784-64458806 GGCTTCTGATCTGATTGGGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1156603288 18:38636011-38636033 TTCCATTAATCTGGTTGTGCTGG - Intergenic
1159666034 18:71161840-71161862 GGCCACAGACCTGGTTCTGATGG + Intergenic
1161235232 19:3194402-3194424 TTCCACTGATCTGGCTGTGTAGG - Intronic
1161328785 19:3676357-3676379 GGCCACTCACCAGGGTGTGCTGG - Intronic
1161394724 19:4038904-4038926 GGCCCCTGGTCTGGTCCTGCTGG - Exonic
1162041084 19:7971443-7971465 GGCATCTGAGCTGGCTGTGCAGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163577636 19:18119994-18120016 GGCAACTGCTCTGGTGGGGCGGG + Intronic
1163712671 19:18856060-18856082 TGTTCCTGATCTGGTTGTGCAGG - Exonic
1165743805 19:38218701-38218723 GGCCACTGACCTGCTTTTGAGGG + Intronic
1166326176 19:42052442-42052464 GGCCAGTGATCCTGTTGTGGAGG - Intronic
1167137149 19:47623638-47623660 AGACACTGATCTGGCTTTGCAGG - Intronic
926215828 2:10904844-10904866 GGCCACTAATCTTGTTGGGCTGG + Intergenic
928460163 2:31464968-31464990 TGCCATTTATCTGGTTGTTCAGG - Intergenic
928949757 2:36804303-36804325 GGGCACAGGTCTGGTTGGGCAGG - Intronic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
938673005 2:133603171-133603193 GGCCACTGCTCTGCTTCTGGGGG - Intergenic
946087223 2:217186250-217186272 GGTCACTGATATGGGTGAGCAGG - Intergenic
948762998 2:240204170-240204192 GGCCCGTGAGCTGGCTGTGCTGG - Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1171461168 20:25298830-25298852 GGCCTCAGACCTGGTCGTGCAGG + Intronic
1175256674 20:57652163-57652185 GCCCACTGCTCTGCTGGTGCTGG + Exonic
1177282695 21:19004219-19004241 GGCCAATGATCTGAATGAGCTGG + Intergenic
1177720655 21:24902705-24902727 GGACACTGCTCTGGTTATGATGG - Intergenic
1178872544 21:36388344-36388366 GGCGACTGTTCTGGTTTTGTTGG + Intronic
1180614827 22:17120413-17120435 CGCCACTGACCTGGTGGTGGTGG - Exonic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1180865538 22:19116993-19117015 GGGAGGTGATCTGGTTGTGCAGG - Intronic
1180865558 22:19117155-19117177 GGCCGGTGATTTGTTTGTGCAGG - Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183584197 22:38742720-38742742 GACCTCTGAGCTGGGTGTGCTGG + Intronic
1184661982 22:45969639-45969661 TGCCACTGATCAGGTTGGACGGG - Intronic
1184798287 22:46744671-46744693 GGCCTCTGCCCTGGCTGTGCTGG - Intergenic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
950066478 3:10115856-10115878 GGCCGCTGAGGTGGTTGGGCTGG + Intronic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959495652 3:107048413-107048435 AGCCATTCATCTAGTTGTGCAGG + Intergenic
961467203 3:127089193-127089215 GGCCACTGCTCTGAGTGTCCTGG + Intergenic
961638601 3:128350383-128350405 GGCCACTGAGCCTGTTCTGCTGG + Intronic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
961811242 3:129523116-129523138 GGCCAGTGTTCTGGATCTGCAGG - Intergenic
963903187 3:150752196-150752218 GGGCAGTTATGTGGTTGTGCAGG - Intronic
965424825 3:168509077-168509099 GGCCGCTGCTCTGGTTCTTCTGG + Intergenic
965794194 3:172421720-172421742 GGCCACTGAGCTGATTGTGGAGG - Intergenic
966234532 3:177686227-177686249 GGCCCCTGATCTGCTGGAGCTGG - Intergenic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
968079372 3:195835724-195835746 GGCCACTGCTCTGGTCCTGCTGG - Intergenic
969592382 4:8129346-8129368 GGCAGCTGAGCTGGGTGTGCAGG - Intronic
970471509 4:16384067-16384089 GGCCATTTATCTGGTTGTAAAGG + Intergenic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
976970536 4:91096518-91096540 GGGAACTGATCTGGGTGTCCTGG + Intronic
982837048 4:160131670-160131692 TGCCACTGGTGTGGTTTTGCTGG - Intergenic
988590503 5:32544740-32544762 GGCGACTGTGCTGGTTGTCCGGG - Intronic
989321922 5:40144681-40144703 GGTCCCTAATGTGGTTGTGCAGG + Intergenic
994690241 5:103009575-103009597 TGCCACTGATCTGGTTACTCAGG + Intronic
995473308 5:112525106-112525128 GGCAACTGATCTGGGTGCCCTGG - Intergenic
997611393 5:135218185-135218207 GGCCACTAATCTGCTCCTGCAGG - Intronic
999063362 5:148658609-148658631 CTCCACTGAGCTGGTTGTACAGG - Intronic
999690349 5:154140952-154140974 TGCCACTGAACTGGGTGTGGGGG - Intronic
1000919328 5:167119775-167119797 GGCCACTGTGCTGGTCGTGGAGG + Intergenic
1001732293 5:173969317-173969339 GGCCACCGTTCTGGTAATGCAGG + Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006815587 6:36847735-36847757 GGGCACAGATCTTGTGGTGCTGG - Intergenic
1018707791 6:166475569-166475591 GGCCACTGATCTATTTGAGTGGG - Intronic
1019130557 6:169869966-169869988 GGCCACAGATCTGCTTCTGGAGG + Intergenic
1020577632 7:9954709-9954731 GGCCACAGATCTAGTGGTGTAGG + Intergenic
1024243677 7:47454103-47454125 GCCCACTGATAGGGTTATGCTGG - Intronic
1029111528 7:98215107-98215129 GGTCTCTGACCTGCTTGTGCAGG - Exonic
1029447828 7:100624250-100624272 GGCCCCTGTTCTGGCTCTGCTGG + Intronic
1030344222 7:108414846-108414868 GCCCACTGTTGTGGTTGTGCTGG - Intronic
1034696412 7:153058048-153058070 GGCCACTGAGGTGGTTTTGGGGG + Intergenic
1035050738 7:155997870-155997892 GGCCTCTGTTCTGGGGGTGCTGG + Intergenic
1035106630 7:156446540-156446562 GGCCTCTGATGTGGAGGTGCAGG + Intergenic
1043655737 8:82662969-82662991 GGCTGCTGATCTGGATGAGCAGG + Intergenic
1046234888 8:111410354-111410376 AGCCACTGATCAGGTTTGGCAGG - Intergenic
1046630804 8:116621507-116621529 TTCTACTGCTCTGGTTGTGCTGG - Intergenic
1047351767 8:124080912-124080934 GGCCAGGGATATGGTTGTGTGGG - Intronic
1054770299 9:69077268-69077290 GGCCACTGATCAGGTACTTCGGG - Intronic
1056083500 9:83122144-83122166 GGCCACGGATGTGGGTGTGCTGG - Intergenic
1057185284 9:93054044-93054066 GCTGACTGATCTGCTTGTGCAGG + Intergenic
1058753205 9:108059688-108059710 AGCCTCTGAACTGGTTGTTCTGG - Intergenic
1062306367 9:135908962-135908984 GGCCACAGTTCTGACTGTGCAGG - Intergenic
1062439822 9:136564661-136564683 GGGCCCTGACCTGGTTGAGCTGG - Intergenic
1062585994 9:137250355-137250377 GGCCCCTGCCCAGGTTGTGCCGG - Intergenic
1190244887 X:48684467-48684489 GGACACAGATCTGGGTTTGCGGG - Intronic
1191036541 X:56030948-56030970 GGGAACTGATCTGGGTGTCCTGG + Intergenic
1195713409 X:107794277-107794299 GGCCACTGAACTGATGGTCCCGG - Exonic
1197193637 X:123676402-123676424 CACCACTGATCTGGGTGTGGGGG + Intronic
1198969542 X:142266377-142266399 GGGAACTGATCTGGGTGTCCTGG - Intergenic