ID: 923019434

View in Genome Browser
Species Human (GRCh38)
Location 1:230151520-230151542
Sequence CAGGGCTATCTTGGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923019434_923019444 24 Left 923019434 1:230151520-230151542 CCGGCCTCCCCAAGATAGCCCTG 0: 1
1: 0
2: 1
3: 15
4: 236
Right 923019444 1:230151567-230151589 ACAGCAGTGCCTTCTTCTGTAGG 0: 1
1: 0
2: 1
3: 27
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923019434 Original CRISPR CAGGGCTATCTTGGGGAGGC CGG (reversed) Intronic
900160047 1:1219180-1219202 CCAGGCTGTCTTGGGGAGTCCGG - Intronic
900431358 1:2604599-2604621 CAGGGCTAACTTGGGCCTGCCGG + Intronic
900484345 1:2914381-2914403 CAGGGCTTTCCTGGGCAAGCTGG + Intergenic
900831616 1:4969671-4969693 CAGGGAGGTCATGGGGAGGCTGG + Intergenic
900878130 1:5360598-5360620 CAGGATTATCATGGGGAGGGAGG + Intergenic
901418910 1:9137091-9137113 CAGGGCCCCCTTGGGGATGCTGG - Intergenic
901438298 1:9262744-9262766 CAGGGCTTTCTGGGAGAGGCTGG + Intronic
903179560 1:21598347-21598369 CAGGGCTACCTTGGGGTAGGAGG - Intronic
903810380 1:26031770-26031792 CAGATGTCTCTTGGGGAGGCTGG + Intronic
907620259 1:55970818-55970840 CAAGGTTATTTTGGGGAAGCTGG + Intergenic
908457903 1:64322001-64322023 CAGGGCTGACATGGGAAGGCTGG - Intergenic
909980848 1:82099002-82099024 GAGGGGTAACTTGGGGAGCCAGG - Intergenic
911068099 1:93810003-93810025 TAGAGCTATCTTGGCCAGGCTGG - Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
917417516 1:174826047-174826069 CAGGACTATTTGAGGGAGGCAGG - Intronic
919870884 1:201820334-201820356 GAGGGAGATCTGGGGGAGGCAGG + Exonic
920303868 1:205006501-205006523 CTGGGCTTTCTTGGGCAGGAGGG + Intronic
920705834 1:208249743-208249765 CAGGGCTTTCTCGGGGTGGGGGG + Intergenic
922649201 1:227322332-227322354 CAGGGCTATGTTGGCCAGGCTGG + Intergenic
922962497 1:229660931-229660953 CTGTGCTATCTTGTGGGGGCTGG + Intergenic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
924460258 1:244252846-244252868 GTGGGCTAACCTGGGGAGGCTGG + Intergenic
1063811454 10:9713549-9713571 GAGGGCTATTTTGAGAAGGCAGG - Intergenic
1064173653 10:13055518-13055540 CAGGGCTATGTTGCCTAGGCTGG + Intronic
1064265369 10:13821250-13821272 CAGGGCTGTGCTGGAGAGGCAGG - Intronic
1065058465 10:21872263-21872285 CAGGGTTATGTTGGCCAGGCTGG + Intronic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1069936612 10:71921869-71921891 CAGGGCCAGCTTGGGCAGGAGGG - Intergenic
1070098167 10:73358654-73358676 CAGGGCTGAGGTGGGGAGGCCGG + Intronic
1070098410 10:73361187-73361209 CAGGGCCATGTTGGCCAGGCTGG + Intergenic
1070168191 10:73913502-73913524 GAGGGATGTCTTAGGGAGGCAGG - Intronic
1072787447 10:98293869-98293891 CTGGGCAATCCTGGGCAGGCTGG + Intergenic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073301778 10:102475367-102475389 CAGGGACATCTTTGGGAGACTGG + Intronic
1073324907 10:102636988-102637010 TAGGGCTATCTGGGGGAAGATGG + Intergenic
1074149029 10:110741818-110741840 CAGGGCTCTCCTGGGGAGGGAGG - Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1076613908 10:131743797-131743819 CAGGGCTGTCTGGGAGATGCTGG - Intergenic
1076728022 10:132422277-132422299 CAGGGCTCTCTGTGGGAGCCGGG + Intergenic
1077700253 11:4434790-4434812 GAGAGCTATCTGGAGGAGGCTGG - Intergenic
1081565899 11:44261144-44261166 CAGGCCTAGCTGGGGGAGGATGG - Exonic
1084600225 11:70141135-70141157 CAGGGCCCTCTTGGGGTAGCAGG + Intronic
1085301695 11:75462586-75462608 CAGGGCTTTGGTGAGGAGGCTGG - Intronic
1087290269 11:96313519-96313541 TGGGGCAATTTTGGGGAGGCTGG - Intronic
1087696380 11:101381306-101381328 CAATTTTATCTTGGGGAGGCTGG - Intergenic
1089368363 11:117934906-117934928 AAGGGCTGTCTTGGGGAAGTGGG - Intergenic
1090076741 11:123584497-123584519 CAGGGCAGCCTTGGGGAGGGAGG + Intronic
1090212553 11:124932596-124932618 AAGGTAAATCTTGGGGAGGCAGG + Intronic
1091849793 12:3686452-3686474 CTGGGCAGTGTTGGGGAGGCAGG + Intronic
1092132248 12:6120705-6120727 CAGGGCTGTTGTGGGGATGCAGG + Intronic
1092964055 12:13624791-13624813 CTGGGCTCTCTTGGAGAGGCAGG - Intronic
1093057023 12:14566157-14566179 CAGAGGTACCTGGGGGAGGCTGG - Intronic
1093829449 12:23737749-23737771 CAGGAATATCCTTGGGAGGCAGG - Intronic
1096162850 12:49394874-49394896 CAGGGTTATGTTGGCCAGGCTGG - Intronic
1096391036 12:51229223-51229245 TAGGACTGTCTCGGGGAGGCTGG + Intergenic
1096754261 12:53785620-53785642 CAGGGCAATCTTCTAGAGGCAGG + Intergenic
1101062376 12:100985653-100985675 GAGGGTTCTCTTGGGGAGGAGGG + Intronic
1103729053 12:123013875-123013897 CAGGGCTGCCTTGGGCAGGATGG + Exonic
1104222480 12:126798460-126798482 CAGGTCTATCTTTAGGAGACAGG - Intergenic
1104981942 12:132577152-132577174 CAGGTCCACCCTGGGGAGGCTGG - Intronic
1106009553 13:25806154-25806176 CAGGGGTAAGTTGAGGAGGCGGG + Intronic
1106502841 13:30345933-30345955 GTGGGCTGTGTTGGGGAGGCAGG - Intergenic
1107466988 13:40660160-40660182 CAGGGAGATCCTGGGGGGGCTGG + Intronic
1109575059 13:64244744-64244766 CTGGGCTATTTTGGGATGGCAGG + Intergenic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1114826624 14:26088547-26088569 CAGGGCTTACTGGGGGGGGCAGG - Intergenic
1115137372 14:30127193-30127215 TGGGGCTAGGTTGGGGAGGCTGG - Intronic
1115473372 14:33791249-33791271 CACGGCTTCCTTGGGGAGTCGGG - Intronic
1118633723 14:67728690-67728712 CAGGGATATCTTGTGGGGGGGGG + Intronic
1120740600 14:88105537-88105559 CATGGCTATCTTTGGGACCCAGG + Intergenic
1120846943 14:89134432-89134454 TAGGGTTTTCTTGTGGAGGCTGG + Intronic
1121121763 14:91380230-91380252 TTCGGCTATCTTGGGGCGGCTGG + Intronic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1121958606 14:98237982-98238004 CAGTCCTATCTTGGGGAGATGGG + Intergenic
1122276615 14:100593995-100594017 CAGGGCAGTCGTGGGCAGGCAGG - Intergenic
1122417086 14:101555148-101555170 CAGGGCTGTGTTGTGGTGGCAGG - Intergenic
1122773608 14:104107732-104107754 CAGGGCTTGCTTGGTGGGGCAGG - Intronic
1123032092 14:105456767-105456789 CAGGGGTACCCTGGGGAAGCTGG - Intronic
1123501214 15:20882772-20882794 GAGGGCTGTTTTGGGAAGGCAGG - Intergenic
1123558466 15:21456477-21456499 GAGGGCTGTTTTGGGAAGGCAGG - Intergenic
1123594697 15:21893752-21893774 GAGGGCTGTTTTGGGAAGGCAGG - Intergenic
1124696248 15:31867094-31867116 CAGGGCTATTTTGGTGAGTTGGG - Intronic
1126100897 15:45117652-45117674 CAGGGCTATGTTGCCCAGGCTGG - Exonic
1126765516 15:52007314-52007336 CAGGGCTATCTTCTGGGGGGTGG + Intronic
1129198608 15:73985417-73985439 CTGGGCTGTCCTGGGGCGGCTGG + Exonic
1129283657 15:74506210-74506232 CAGGGCTATGTGGGGGAGAGTGG - Intergenic
1129766964 15:78175862-78175884 GAGGCATATTTTGGGGAGGCTGG - Intronic
1132040582 15:98521942-98521964 CAGGCTTATCTTGGGGGGGCGGG - Intergenic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1202966816 15_KI270727v1_random:183627-183649 GAGGGCTGTTTTGGGAAGGCAGG - Intergenic
1132545045 16:529032-529054 CTGGCCTGTCTGGGGGAGGCAGG + Intronic
1132745310 16:1433882-1433904 GAGGGCTTTCTTGGAGAGGCAGG + Intergenic
1132749438 16:1450704-1450726 CAGGGCAGTCCTGCGGAGGCGGG - Intronic
1133567245 16:7007525-7007547 CATGGGTATCTTGGGGAAGTGGG + Intronic
1134289706 16:12894022-12894044 CCCGGATATCTTGGGGAGGGGGG + Intergenic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1137672094 16:50284939-50284961 AAGGGCTATTTTGGGGTGGGGGG + Intronic
1137706765 16:50540818-50540840 CAGGGCTATGGTGGGGCGCCAGG - Intergenic
1140299301 16:73740429-73740451 CAGGGCTATATATGGCAGGCAGG + Intergenic
1141468704 16:84223896-84223918 AAGGGCTGTCTTGGGGATTCAGG - Intronic
1141660359 16:85438041-85438063 CAGGCTCATCTGGGGGAGGCGGG + Intergenic
1144240990 17:13311463-13311485 CAGGGCTCTGTGGGGAAGGCTGG - Intergenic
1144737614 17:17563868-17563890 CAGTGCCCTCCTGGGGAGGCGGG - Intronic
1147218113 17:38912579-38912601 CAGGCCTGTCTTTGGGAGTCTGG + Intronic
1147586569 17:41656627-41656649 CAGGGATGGCTTGGGGAGGGTGG + Intergenic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148127568 17:45244805-45244827 CAGGACAATCTGGGAGAGGCAGG - Exonic
1148158700 17:45437694-45437716 CTGGGCTTTCTCTGGGAGGCCGG + Exonic
1148857656 17:50587542-50587564 CCTGGCTATCTGGGGGAGGAGGG + Intronic
1150464749 17:65382939-65382961 CAGGGCTATCTTCAGGAGCAGGG + Intergenic
1151325847 17:73379447-73379469 GAGGTCTTTGTTGGGGAGGCAGG - Exonic
1152241351 17:79163015-79163037 CAGGGCTGTCTGGGGGAGAGAGG + Intronic
1159736114 18:72099878-72099900 CAGGGCTTTGTTGCCGAGGCTGG - Intergenic
1159886367 18:73911529-73911551 CACGGAAATGTTGGGGAGGCCGG + Intergenic
1160263998 18:77322854-77322876 CAGGGCTGTCACGGGGAGTCTGG + Intergenic
1160833621 19:1114403-1114425 CAGGGCGACCTCGGGGACGCGGG - Exonic
1161767810 19:6216693-6216715 CAGGGCGTTCTAGGGGAAGCGGG - Intronic
1162323656 19:9985876-9985898 CAGGGCAAGCTTGGGGTGCCAGG - Exonic
1163157860 19:15449215-15449237 CAGGGAGATGGTGGGGAGGCCGG + Intronic
1163315272 19:16536818-16536840 CAGGGCCATGTTGGCCAGGCTGG - Intronic
1167844710 19:52152506-52152528 CAGGCCAATCTTGGAGAAGCAGG + Intergenic
925104353 2:1277784-1277806 CAGGGCTATGCAGGGGAGGAGGG + Intronic
925611033 2:5703371-5703393 CTGGGGTATCTGGGAGAGGCGGG + Intergenic
925857500 2:8144282-8144304 CTGGGCTCTTTTGGGGTGGCTGG + Intergenic
926088696 2:10036245-10036267 CTGGCCTGTCTGGGGGAGGCTGG + Intergenic
926158574 2:10472289-10472311 GGGGGCTTTCTTGGGGAGACAGG - Intergenic
929656256 2:43734968-43734990 CCTGGCTAACATGGGGAGGCTGG + Intronic
929958681 2:46479958-46479980 GAGGGCTATGGTGGGGAGCCAGG - Intronic
929997239 2:46836387-46836409 CAGGGCTCTCCTGGGGAGCTGGG - Intronic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932757980 2:74421959-74421981 CAGGGCTGTTTTGGGGCGACGGG - Intronic
934651138 2:96091942-96091964 CAGGGGAAGCTTGGTGAGGCAGG + Intergenic
934940867 2:98501062-98501084 CTGGGATATTTTTGGGAGGCCGG + Intronic
934962332 2:98687669-98687691 CAGGGCTATTGTGGGGTGGGTGG - Intronic
936518784 2:113198943-113198965 CAGGACTAACTCGGGGAGGCTGG + Intronic
939062687 2:137442491-137442513 CATGTCTATCTTGGGTTGGCTGG + Intronic
939632786 2:144545459-144545481 CATGGCTATGTTTTGGAGGCAGG + Intergenic
941587290 2:167376470-167376492 CAGGGCTTTCTTGGGTTGGTAGG + Intergenic
941649097 2:168073990-168074012 GAGAGCTACCATGGGGAGGCAGG + Intronic
942129771 2:172866595-172866617 CAGGCCTCACTTTGGGAGGCAGG + Intronic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945976146 2:216272464-216272486 CAGAGCTTGGTTGGGGAGGCAGG - Intronic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946343085 2:219084735-219084757 AGGGGCTATTTTGGGGAGGTAGG - Intronic
946690383 2:222304844-222304866 CAGGGCCACCGTGGGGAGCCGGG - Exonic
948557159 2:238821004-238821026 CTGGGCTCTCTTGGGGAGAGGGG + Intergenic
948659017 2:239495340-239495362 CAGGGCTGGGCTGGGGAGGCAGG + Intergenic
948803576 2:240443535-240443557 CAGGGCTGTGGTGGGGAGGAGGG + Intronic
949037342 2:241821902-241821924 CAGGGCTCTGTCGTGGAGGCAGG + Intergenic
1169109688 20:3024241-3024263 CAGGTCTATCTTGGGGGTGGTGG - Intronic
1169737468 20:8852493-8852515 CAGGCCCATCTTAAGGAGGCTGG - Intronic
1173128525 20:40364246-40364268 CATGGCTTTCTTGGGGTGGAGGG - Intergenic
1173543182 20:43869742-43869764 TAGGGCTTTCTTGGGGAGCAGGG - Intergenic
1174229238 20:49030799-49030821 CAGGGCCATGTTGGCCAGGCTGG - Intronic
1175268399 20:57716541-57716563 CAGAGCGATTTAGGGGAGGCTGG + Intergenic
1175823929 20:61926410-61926432 CAGCGCTGGCTGGGGGAGGCTGG - Intronic
1176161993 20:63652914-63652936 CAGAGCCTTCGTGGGGAGGCGGG - Intronic
1176376164 21:6087786-6087808 CAGGGCCACATTGGGGAGGGTGG - Intergenic
1176378269 21:6097822-6097844 CAGAGATGTCCTGGGGAGGCTGG + Intergenic
1177223626 21:18224898-18224920 CAGGGCGGCCTTAGGGAGGCTGG + Intronic
1177974911 21:27836606-27836628 CAGTGCTTTCCTGGGGAGACCGG - Intergenic
1178271420 21:31193405-31193427 CAGGGCTTTTCTGGGGAGGCTGG - Intronic
1178422800 21:32455725-32455747 CAGGGGTATCTGGCAGAGGCAGG - Intronic
1179427699 21:41294976-41294998 CTGGGCTATCTTGGTAAGGTGGG - Intergenic
1179745203 21:43440425-43440447 CAGAGATGTCCTGGGGAGGCTGG - Intergenic
1179747311 21:43450458-43450480 CAGGGCCACATTGGGGAGGGTGG + Intergenic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1180115175 21:45698481-45698503 CAGGGCTCTCTTGGGGAGAAGGG + Intronic
1180181701 21:46121094-46121116 CAGGGAGCTCTTGGGGAGCCCGG + Exonic
1180900041 22:19364066-19364088 TATGGGTATGTTGGGGAGGCGGG + Intronic
1181352513 22:22268617-22268639 CAGGGCTGTGGTGGGGAGGTGGG + Intergenic
1182146467 22:27999691-27999713 CAAGCCAATCTTGGGGAGACAGG + Intronic
1183456181 22:37924563-37924585 CGGGGCGCTCCTGGGGAGGCAGG + Intronic
1183735709 22:39643729-39643751 CAGTGCTTTCTTGGGGAGGCTGG + Intronic
1183813842 22:40281974-40281996 CAGAGCTATTGTGGGAAGGCAGG - Intronic
1184649845 22:45914719-45914741 CAGGACTATCTCAGGGAGCCAGG - Intergenic
1184693329 22:46127280-46127302 CAGGGCTGTGCTGGGGAGCCAGG - Intergenic
1184923554 22:47622411-47622433 CAGGGCCAGATTGGGGAGGAAGG + Intergenic
951424066 3:22521308-22521330 CAGGGCCAGCTGGGGGAGGGGGG + Intergenic
953884607 3:46708269-46708291 CAGGTCTATTTTGGGGAAGATGG - Intronic
955088005 3:55721674-55721696 CAGGGCTCCCCTGGGGAGGTGGG + Intronic
960774403 3:121232484-121232506 CAGGGCCATGCTGGGGAGACAGG + Intronic
963377731 3:144491548-144491570 AAGGCCTATCTGGGGGAGGCTGG + Intergenic
968889905 4:3363424-3363446 CTGGGGTCTCTCGGGGAGGCTGG - Intronic
970609120 4:17709242-17709264 CAGGGCTCTCCTGGGGCAGCCGG + Exonic
975732811 4:77354196-77354218 TAGGGCTGGCTTGGGGAGGAGGG - Intronic
975734402 4:77367292-77367314 TAGGGCTGGCTTGGGGAGGAGGG - Intronic
976018897 4:80595253-80595275 CTGTGCTATCTTTGGGAGGGAGG - Intronic
979612928 4:122708255-122708277 AAGGGGTATCTTGCTGAGGCAGG - Intergenic
985062397 4:186092394-186092416 CAGAGCAGTCTTGCGGAGGCTGG + Intergenic
985683818 5:1271335-1271357 CAGGGCCATCGTGGGCTGGCCGG + Intronic
985697310 5:1347879-1347901 CCGGGCTTTCCTGGGGAGGAAGG + Intergenic
985716646 5:1466822-1466844 CAGGGCCGTCTTGAGGATGCAGG + Exonic
986221849 5:5775489-5775511 CAGGGCTGTACTGGGGAGACAGG + Intergenic
986222030 5:5776519-5776541 CAGGGCAACCCTGGGGAGACAGG + Intergenic
986525359 5:8668289-8668311 CAGGACTACCTTGGGGAAACTGG + Intergenic
986600817 5:9470756-9470778 GAGGTCTGTCTTTGGGAGGCAGG - Intronic
989250115 5:39303791-39303813 CATGACTATCTTTGGGATGCGGG - Intronic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
991466270 5:66915704-66915726 CAGTGCTGTCTTGGGGACACAGG + Intronic
997867452 5:137477272-137477294 TATGGCTATCTTGGGGTGACAGG + Intronic
1000107628 5:158075458-158075480 CGGGGTGATCTTGGGCAGGCGGG - Intergenic
1001263793 5:170257061-170257083 CAGGGCTGGGGTGGGGAGGCGGG + Intronic
1002935655 6:1669986-1670008 CAGGGCTTCCTTGGGAATGCAGG + Intronic
1006423715 6:33950981-33951003 CAGGGCCATCTGGGTGTGGCTGG - Intergenic
1007079315 6:39087467-39087489 CATGGCTATCCTAGAGAGGCTGG + Exonic
1007392612 6:41558740-41558762 CAGGGCTGAATGGGGGAGGCTGG + Intronic
1007435659 6:41808865-41808887 CAGGTCTATGTTGGCTAGGCTGG - Intronic
1008385215 6:50881239-50881261 CTGGCCTATCTGGGGGAGGGGGG + Intergenic
1010234794 6:73566453-73566475 CAGGCCAATTTTGGGGAGGTGGG - Intergenic
1010663428 6:78598220-78598242 CAGGACTATCTTCAAGAGGCAGG - Intergenic
1013082057 6:106821635-106821657 AAGGGATATTCTGGGGAGGCGGG - Intergenic
1017484420 6:154889727-154889749 CAGGTCTGCCCTGGGGAGGCAGG + Intronic
1018383848 6:163285159-163285181 GAGGGGTGTCTGGGGGAGGCTGG - Intronic
1018727322 6:166623696-166623718 CAGAGCTCTCTTGGGGATGAGGG + Intronic
1018820599 6:167370930-167370952 CAGGCCTGTCGTGGGGAGGGGGG + Intronic
1019341851 7:512191-512213 CAGGCCTATTTTAGGGAGGAGGG + Intronic
1023806677 7:43877562-43877584 GAGAGCTGTCTTGTGGAGGCAGG - Exonic
1025262125 7:57426452-57426474 CAGGGCCCTCCTGGGGAGCCAGG - Intergenic
1025860829 7:65326057-65326079 GAGGGCTGTATTGGGAAGGCAGG - Intergenic
1025920660 7:65909072-65909094 CAAGGCTATGTTGGCCAGGCTGG - Intronic
1026930803 7:74221939-74221961 GAGGGCTGGCTTGGGGAGGTGGG + Intronic
1028787407 7:94811346-94811368 CAAAGCAATCCTGGGGAGGCAGG + Intergenic
1029483148 7:100824818-100824840 CAGGGCACTCGTGGGGAGGGAGG - Intronic
1030112628 7:106039567-106039589 CTGGGCTATCCGGGTGAGGCTGG + Intergenic
1032083318 7:128870609-128870631 CAAGGGCATCTTGGGAAGGCAGG + Intronic
1034830731 7:154305352-154305374 CAAGGCTATTTTGGGGAGGATGG - Exonic
1035356757 7:158280317-158280339 CATGGCTGCCTAGGGGAGGCCGG + Intronic
1035861110 8:3028471-3028493 CAGGGCTATCTTAGAGAAACGGG + Intronic
1035873905 8:3166333-3166355 CAGGGCCATGTTGGCCAGGCTGG - Intronic
1040561301 8:48525431-48525453 CAGGGAGCTCTTGTGGAGGCTGG + Intergenic
1042621555 8:70711613-70711635 CAGGGCTTACTTGAGGATGCAGG + Intronic
1042621586 8:70711817-70711839 CAGGGCTTACTTGAGGATGCAGG + Intronic
1045832759 8:106483820-106483842 CAAGGTTATCTGGGGGAGGTTGG - Intronic
1046990231 8:120444830-120444852 CATGTCTTTCTTGGGGGGGCGGG - Intronic
1047997942 8:130354765-130354787 AGTGGCTACCTTGGGGAGGCAGG - Intronic
1048451467 8:134537494-134537516 CTGGGCTATCATTAGGAGGCAGG + Intronic
1049124260 8:140772417-140772439 CAGGCCCATCTTGGCGAGACAGG - Intronic
1049319352 8:141987732-141987754 CAGGGCTGACTAGGAGAGGCTGG + Intergenic
1050013384 9:1208279-1208301 GAGTGGTATCTTGGGGAGACAGG + Intergenic
1050947962 9:11549938-11549960 CAGGGATATCTTTGTGAGTCTGG - Intergenic
1051015109 9:12464640-12464662 CAGGGCTCTCTTGTGGATGATGG + Intergenic
1051182148 9:14422796-14422818 CAGGGCTATCTATGGCTGGCAGG - Intergenic
1059172897 9:112143381-112143403 CAAGCCTGTGTTGGGGAGGCAGG - Intronic
1061507018 9:131037133-131037155 CAGGACTCTCTGGTGGAGGCAGG - Intronic
1191860411 X:65661822-65661844 CAGGGCCATGTTGGCCAGGCAGG - Intronic
1195285018 X:103376038-103376060 GAGGGCTAAGGTGGGGAGGCAGG - Intergenic
1197328634 X:125125733-125125755 CTGCACTATCTTGAGGAGGCAGG + Intergenic
1199345588 X:146734866-146734888 CTGCTCTCTCTTGGGGAGGCAGG - Intergenic
1200919574 Y:8601362-8601384 CAGGGCTGTCTTGGAAAGGCAGG - Intergenic
1200960390 Y:8991179-8991201 CAGGGCTCTCTGGGAAAGGCAGG - Intergenic
1200964839 Y:9026407-9026429 CAGGGCTATCCAGGAAAGGCAGG + Intergenic