ID: 923021527

View in Genome Browser
Species Human (GRCh38)
Location 1:230167789-230167811
Sequence GGCCACAGTGGAGCAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923021527_923021537 13 Left 923021527 1:230167789-230167811 CCTGCGGCTGCTCCACTGTGGCC 0: 1
1: 0
2: 2
3: 34
4: 248
Right 923021537 1:230167825-230167847 CATCACCAAGTGCTGCCTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 188
923021527_923021536 12 Left 923021527 1:230167789-230167811 CCTGCGGCTGCTCCACTGTGGCC 0: 1
1: 0
2: 2
3: 34
4: 248
Right 923021536 1:230167824-230167846 TCATCACCAAGTGCTGCCTGAGG 0: 1
1: 0
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923021527 Original CRISPR GGCCACAGTGGAGCAGCCGC AGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900345624 1:2209003-2209025 GGCCAGGGTGGAGCAGCTGCTGG - Intronic
900369023 1:2323303-2323325 TGCCACCGTGGAGCTGCCTCTGG - Intronic
900480125 1:2894180-2894202 GCTCATGGTGGAGCAGCCGCTGG - Intergenic
900512600 1:3067697-3067719 GGTCTCAGTGGAGCCGCCACAGG + Intergenic
900736545 1:4302875-4302897 GGCCATGGAGGAGCAGCAGCAGG - Intergenic
900951302 1:5859539-5859561 GGCCACAGTGGAGGAGATGAAGG + Intergenic
901323227 1:8351839-8351861 GGCCACAGGGGGGCAGGCGTTGG - Intergenic
901737591 1:11322258-11322280 GGCCACAGTGGGGAGCCCGCAGG - Intergenic
901758026 1:11453256-11453278 GGCGACGGTGGAGCAGGGGCAGG - Intergenic
901818008 1:11805919-11805941 GGCCACAGTGGTGCGGCCGGCGG - Intronic
901953872 1:12770262-12770284 GGGCACGGTGGGGCAGCCCCTGG + Intergenic
902336979 1:15759330-15759352 GCCCAGAGAGGAGCAGCCCCGGG - Intronic
903129451 1:21269054-21269076 GAACTCTGTGGAGCAGCCGCTGG + Intronic
904117625 1:28174249-28174271 GGCAACAGTGGAGCAGGAGCCGG - Intronic
905038222 1:34930539-34930561 GGCCACGGTGGGGAAGCCGCAGG + Intergenic
905582008 1:39089419-39089441 GGCCACAATGGAGCAGATGTTGG - Intronic
907330678 1:53669275-53669297 GGCTACAGTGGGGCACCCACAGG + Intronic
908718293 1:67094635-67094657 GGCCTCAGTGGAGCAGTCTGGGG + Intronic
909931339 1:81503040-81503062 CGCCGCACTGGAGCAGCTGCGGG + Intronic
913597684 1:120394138-120394160 GGCAACAGTGGAGCCGCTGAGGG + Intergenic
914089649 1:144485176-144485198 GGCAACAGTGGAGCCGCTGAGGG - Intergenic
914308964 1:146449040-146449062 GGCAACAGTGGAGCCGCTGAGGG + Intergenic
914593149 1:149124091-149124113 GGCAACAGTGGAGCCGCTGAGGG - Intergenic
915537692 1:156547192-156547214 GGCCACACTGGACCATCCACGGG + Intronic
918066489 1:181105288-181105310 GACCTCACTGGGGCAGCCGCGGG - Intergenic
919815423 1:201435118-201435140 GGTCTCAGTGTAGCAGCCCCGGG - Intergenic
920342890 1:205286697-205286719 TGCCTCTGTGGAGCAGCGGCAGG - Intergenic
923021527 1:230167789-230167811 GGCCACAGTGGAGCAGCCGCAGG - Intronic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1067763462 10:49068364-49068386 GGGAACAGTAGAGCAGCTGCAGG + Intronic
1067850901 10:49752866-49752888 GGCAGCAGTGAAGTAGCCGCGGG - Intronic
1069694123 10:70374282-70374304 GGCAAGAGTGGAGAGGCCGCAGG - Intronic
1070407809 10:76112385-76112407 GGACAGAGTGGAGCCGGCGCCGG + Intronic
1070866543 10:79710662-79710684 GGGCAAAGTGAAGCAGCCACAGG + Exonic
1070880333 10:79848793-79848815 GGGCAAAGTGAAGCAGCCACAGG + Exonic
1072247583 10:93556905-93556927 AGCCCCAGTGGAGCAGACTCAGG - Intergenic
1072609871 10:97010978-97011000 GGCTACAGGTGAGCAGCCCCTGG - Exonic
1073446684 10:103585120-103585142 AGCCACAATGGCGCGGCCGCCGG + Exonic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1076781826 10:132728806-132728828 GCACGCACTGGAGCAGCCGCGGG + Intronic
1077018964 11:409122-409144 GGCCACAGTTGAGCTGCCCCAGG + Intronic
1077152469 11:1078433-1078455 GGCCACGGTGCTGCAGACGCAGG - Intergenic
1078267451 11:9765767-9765789 GGCCACAGGGGAGGAGATGCCGG + Intergenic
1081563601 11:44241917-44241939 GCCCACACTGGAGAAGCGGCAGG - Intronic
1081685535 11:45040407-45040429 GCCCACAGTGGATAAGCTGCAGG - Intergenic
1081811053 11:45914310-45914332 GGATACAGTGCAGCAGCGGCCGG + Exonic
1083827998 11:65213944-65213966 GGCCGCAGGGCAGCAGCAGCAGG - Intergenic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084086614 11:66857888-66857910 GCGCACAGTGGAGCTGCGGCTGG + Exonic
1084267511 11:68012542-68012564 GACCTCAGTGGCTCAGCCGCAGG + Intronic
1084271952 11:68033659-68033681 GGCCTCAGGGGAGCAGCCACTGG - Intronic
1084557361 11:69883056-69883078 GGCCACAGCGAAGGAGCAGCTGG - Intergenic
1084736476 11:71108673-71108695 GGCTACAGCTGAGCAGCCCCAGG - Intronic
1084747635 11:71183405-71183427 GGCCACAGGGCTGCAGCTGCTGG + Intronic
1084790865 11:71474618-71474640 GGCCCCTGTGGAGAAGCCCCCGG + Intronic
1084790890 11:71474690-71474712 GGCCCCTGTGGAGAAGCCCCCGG + Intronic
1085803354 11:79611812-79611834 GGGCACAGAAGAGCAGCAGCTGG + Intergenic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1089167021 11:116485213-116485235 GACCACAGTGCAGCAGCCAAAGG + Intergenic
1089214723 11:116828891-116828913 GCCCACAGTGAAGCCGCAGCAGG - Intergenic
1090645539 11:128764376-128764398 GGCCACAGCAGAGCTGCCGAGGG - Intronic
1090863258 11:130673052-130673074 GGCCAGAATGGAGAGGCCGCTGG - Exonic
1096005640 12:48168843-48168865 GCCCTCACTGGAGCAGCCGGAGG + Intronic
1096405114 12:51338401-51338423 GGCTAGAGTAGAGCAGCGGCTGG - Intronic
1097166551 12:57089289-57089311 CCCCACAGCCGAGCAGCCGCCGG + Exonic
1098195110 12:67991454-67991476 AGCCACAGTCGAGCATCCCCTGG - Intergenic
1098320650 12:69239937-69239959 GGCCGCTGTGCAGCTGCCGCCGG + Intronic
1101179814 12:102203465-102203487 AGCGAAAGTGGAGCAGTCGCAGG - Intergenic
1102040664 12:109798703-109798725 GGGCACACTTGAGCAGCAGCAGG + Exonic
1102819440 12:115895443-115895465 GGCCACAGGGGAGCAGCACCAGG + Intergenic
1103010628 12:117455771-117455793 GCCTACAGTTGAGCAGCCGAAGG - Exonic
1103333305 12:120170051-120170073 GACCACACTGGATCAGCCACAGG - Intronic
1104953219 12:132451630-132451652 GGCCAGTGAGGAGCAGCCACAGG + Intergenic
1105245325 13:18645175-18645197 GGCCACAGAGCAGCAGCAGGAGG - Intergenic
1105298932 13:19116425-19116447 GCCCACAGTACAGCACCCGCAGG + Intergenic
1111747722 13:92291173-92291195 GGGCACAGTGGAGCAGGGGGTGG - Intronic
1112502890 13:99956113-99956135 GGCCGCAGTGGAGCTGCGCCCGG + Intergenic
1113708335 13:112448067-112448089 GGCCACAGTGCAGCGGGGGCGGG - Intergenic
1113803254 13:113097064-113097086 GCCCACAGAGGAGGGGCCGCAGG + Exonic
1113905963 13:113819307-113819329 GGCCACAGGGGAGGCCCCGCTGG - Intergenic
1118436131 14:65772309-65772331 GGCCACAGAGGAGGAGCAGCAGG - Intergenic
1119185561 14:72639598-72639620 GGCCTCAGTGCAGCAGCCCAAGG + Intronic
1121536618 14:94695435-94695457 GGACACAGTAGCGCAGCAGCGGG - Intergenic
1122437823 14:101711599-101711621 TGCCACAGGGGAGCAGCAGCTGG + Intergenic
1122650979 14:103226974-103226996 GGCTGGAGTGGAGCAGCCCCGGG - Intergenic
1123909687 15:24954985-24955007 GCGCAGAGTGGAGCGGCCGCCGG + Exonic
1124364801 15:29063918-29063940 GGCCACACTGGAGCTGCTGGGGG + Intronic
1124554096 15:30709454-30709476 CTCCACAGAGGGGCAGCCGCTGG - Intronic
1124677149 15:31696217-31696239 CTCCACAGAGGGGCAGCCGCTGG + Intronic
1125095243 15:35842849-35842871 GGTCACAGTAGAGAAGCAGCAGG + Intergenic
1126523288 15:49621184-49621206 GGCCCCAGAGGTGCGGCCGCGGG + Intronic
1128140978 15:65301005-65301027 GGCCCCAGTGGAGGATCCACTGG - Intergenic
1128887504 15:71302410-71302432 GGACACAGCAGAGCAGCAGCAGG + Intronic
1129249876 15:74302959-74302981 AGCCACAGTGCAGGAGCCTCAGG - Intronic
1129294333 15:74591648-74591670 CGCCGCACTGGAGCAGCTGCGGG + Exonic
1130132917 15:81158949-81158971 GGGCACCGTGGAGCAGGCGGCGG - Intergenic
1130742834 15:86619665-86619687 GGCCACTGTGGCCCAGGCGCTGG - Intronic
1132210715 15:100020229-100020251 GTCCAAAGTGGAGCAGCAGCGGG - Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132606185 16:794696-794718 GGGCAGCGTGGAGCAGCGGCGGG + Intronic
1132888461 16:2192981-2193003 GGCGACAGGAGAGCATCCGCAGG - Intronic
1133307464 16:4819650-4819672 GGTCAAAGTGGAGGAGCTGCCGG - Intronic
1135185797 16:20314744-20314766 GGCCACAGTGTTGCAGTCACTGG - Intronic
1135480042 16:22814544-22814566 GGCCACAGCAGCTCAGCCGCCGG + Exonic
1136613505 16:31381330-31381352 GCCCAGAGTGGAGCAGACACTGG - Intronic
1138497528 16:57417207-57417229 GGCCACAAGGGAGCAGCAGGAGG - Intergenic
1139654527 16:68379246-68379268 GACCACAGTGGAGCAGATGCTGG + Intronic
1139921457 16:70463184-70463206 GGCCAGAATGGAGCAGCCGAAGG + Exonic
1141536032 16:84680378-84680400 GGGAACAGTGGTGCGGCCGCTGG + Intergenic
1141636531 16:85316911-85316933 GGCCACAGAGCAGGAGCCCCGGG + Intergenic
1141657370 16:85423354-85423376 GGCCACGGCAGAGCAGCAGCTGG - Intergenic
1142131298 16:88432762-88432784 GTTCACAGGGAAGCAGCCGCAGG - Exonic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1143155285 17:4832860-4832882 GGCAACAGTGGAGCCGCTGAGGG - Intergenic
1143726507 17:8850577-8850599 GGTCACAGTGGAGCAGACAGAGG - Intronic
1146668769 17:34722557-34722579 GGCCGCAGTGGAGCAGCTCCTGG + Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1146912524 17:36657898-36657920 GGCCGCCGCCGAGCAGCCGCGGG - Intergenic
1148241184 17:46000399-46000421 GGCCGCACTGGAGCACCAGCTGG + Intronic
1150620796 17:66806550-66806572 GCCCAGAATGGAGCAGCAGCAGG + Exonic
1150832913 17:68540116-68540138 GCCATCAGTGAAGCAGCCGCAGG + Intronic
1151422455 17:74007401-74007423 GGTCACAGTGGAGCTGCTCCTGG + Intergenic
1152426637 17:80221625-80221647 GGCCGCAGGGGAGCAGCAGCAGG - Exonic
1152630012 17:81406696-81406718 GGCCCCAGAGCAGCTGCCGCGGG + Intronic
1152849853 17:82626945-82626967 CGCCACAGTGGACCAGCCAGTGG - Intronic
1153773283 18:8432547-8432569 GGGCACTGTGGAGGAGCAGCAGG - Intergenic
1154299709 18:13182448-13182470 GGGTCCAGGGGAGCAGCCGCAGG - Intergenic
1154337508 18:13477355-13477377 GGCCACAGAGGACCTGCTGCTGG - Intronic
1154443621 18:14414772-14414794 GGCCACAGAGCAGCAGCAGGAGG + Intergenic
1156264937 18:35479383-35479405 GGCCACGGTGGCGCAGTAGCTGG - Exonic
1156497497 18:37535742-37535764 GGCCACAGAGGAGCATGCTCAGG + Intronic
1156789460 18:40953834-40953856 TGCCACAGAGGAGGAGCCCCTGG + Intergenic
1158732857 18:60044916-60044938 GGACACAGGGGAGCAGCAGCAGG + Intergenic
1160282171 18:77501439-77501461 GAGCTCAGTGGAGCAGCCACAGG - Intergenic
1162078745 19:8206213-8206235 CGCCCCAGTGGAGAAGCCCCAGG - Intronic
1163019518 19:14474928-14474950 GACCGCAGTGGAGCAGAGGCAGG - Intronic
1163471562 19:17500349-17500371 GGACACAATGGAGCTGCTGCGGG + Exonic
1163594279 19:18211758-18211780 GGCCTCAGTGGAGAAGTCCCAGG - Exonic
1167852266 19:52211277-52211299 GGCCACAGTGGAGGAGACAGTGG + Exonic
925923129 2:8651283-8651305 GCGCACAGTGGAGCAGCCTCAGG + Intergenic
926218814 2:10921758-10921780 GGCCACAGTGGGGCTGCCCCAGG - Intergenic
926331572 2:11829980-11830002 TGCCACAGGAGAGAAGCCGCTGG + Intergenic
930048219 2:47192624-47192646 GCCCACCGTGGAGCTGCGGCTGG - Intergenic
931184904 2:59940448-59940470 TGCCACAGTGGAGAAACCGATGG + Intergenic
931711079 2:64989407-64989429 AGCCTCCCTGGAGCAGCCGCCGG - Exonic
932462801 2:71894208-71894230 GTGAACAGAGGAGCAGCCGCAGG - Intergenic
932818233 2:74878638-74878660 GGCCACAGTGGGTCAGACACAGG + Intronic
936017648 2:108971943-108971965 GGCAACAGAGGAGCAGCCGTGGG + Intronic
938206271 2:129426962-129426984 GGACACGGTGGAACAGCCACAGG - Intergenic
938246226 2:129779916-129779938 GGCCAGACTGGAGCAGGCTCTGG - Intergenic
938787452 2:134645308-134645330 GGGCACAGTAGAGCTGCTGCTGG - Intronic
946177304 2:217929520-217929542 GGCCACAGGGAAGCACCAGCAGG + Intronic
948605837 2:239134266-239134288 GGTCTTACTGGAGCAGCCGCCGG - Exonic
948865018 2:240770844-240770866 GGCCATTGTGGAGCATCAGCAGG - Intronic
948921754 2:241069167-241069189 GGCCACTGGGCAGGAGCCGCTGG + Intronic
948976766 2:241468292-241468314 GGCGGTAGTGCAGCAGCCGCTGG - Exonic
949037426 2:241822254-241822276 GGCCACAGCTGAGGAGCCGGTGG + Intergenic
1169893246 20:10475532-10475554 GCCCACAGTGAAGCTGCCTCAGG - Intronic
1171173328 20:23034344-23034366 GGACACCCAGGAGCAGCCGCCGG - Intergenic
1171935817 20:31274187-31274209 GGGCAGAGAGGAGCAGCAGCAGG - Intergenic
1172109921 20:32538633-32538655 TCCCAGAGTGGAGCAGCCCCAGG - Intronic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1172843077 20:37913721-37913743 GGCCAGAGTGGAGCTGCGCCTGG + Intronic
1174197134 20:48781486-48781508 GGCCACAATGGTGCAGCCCCTGG + Intronic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1175782699 20:61693575-61693597 GGCTGCAGTGGAGCGGACGCAGG - Intronic
1176196232 20:63837344-63837366 GGACATAGTGGAGCAGGCACGGG + Intergenic
1176452467 21:6876466-6876488 GGCCACAGAGCAGCAGCAGGAGG - Intergenic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176830640 21:13741515-13741537 GGCCACAGAGCAGCAGCAGGAGG - Intergenic
1177894543 21:26844420-26844442 CGCCCCAGGGGAGAAGCCGCCGG - Exonic
1180231696 21:46430324-46430346 GGCCGCAGTTGGGCAGCCCCAGG + Intronic
1181007963 22:20023165-20023187 TGCACCAGGGGAGCAGCCGCTGG - Intronic
1181051962 22:20242142-20242164 GGCCACCGATGAGGAGCCGCTGG - Exonic
1182880856 22:33732248-33732270 GCCCACAGAGAAGCAGCCTCGGG + Intronic
1183352344 22:37341307-37341329 GGCCACAGTGGTGGAGCAGCAGG - Intergenic
1183948109 22:41338278-41338300 GGCCACAGTGGCGCTGTGGCTGG - Intronic
1184960076 22:47922243-47922265 TGGCACAGTAGAGCAGCAGCTGG - Intergenic
1185235049 22:49707345-49707367 CCCCACACTGGAGCAGCCCCTGG + Intergenic
1185324990 22:50221197-50221219 GGCCACGGTGGAACACCCACGGG - Exonic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
953154498 3:40356810-40356832 GGCCAGAGGGGAGCACCAGCTGG + Intergenic
954652983 3:52176470-52176492 AGCCACAGTGGAGGAGGAGCTGG - Intergenic
955971940 3:64445227-64445249 GGCCACAGGTGCGCAGCCGCGGG + Intronic
956103593 3:65793672-65793694 GGCCTGGGTGGAGCAGCTGCAGG + Intronic
958006447 3:87818316-87818338 GGTGACAGTGGAGCAGCTTCAGG + Intergenic
961591422 3:127984523-127984545 GGCCACAGGAGAGCAGCAGAGGG + Exonic
967210275 3:187162272-187162294 GCCCAGAGGGGAGCAGCCGAGGG - Intronic
968502301 4:956353-956375 GGCCGCGGAGGAGCAGACGCTGG - Intronic
968554849 4:1241737-1241759 GGCCACAGGGGCGCGGCCTCGGG - Intronic
968566480 4:1316229-1316251 GGCTACAGCTGAGCAGACGCTGG + Intronic
968578744 4:1379970-1379992 GGCCACGGTGGTGCAGGCACAGG - Intronic
968590944 4:1459348-1459370 GGCCACACAGGAGAAGCTGCGGG + Intergenic
968998791 4:3963814-3963836 GGCCACAGTGCAGTTGACGCAGG + Intergenic
969053008 4:4386233-4386255 GGGCACAGAGGAGGGGCCGCTGG - Exonic
969192375 4:5532651-5532673 GGCCACACTTAGGCAGCCGCTGG - Intergenic
969612755 4:8236358-8236380 GGCCACGCTGGAGGAGCCCCAGG + Exonic
969867755 4:10086599-10086621 GGCCAGCCTGGAGCAGCCCCCGG - Intronic
972836742 4:42880256-42880278 ATTCACAGTGGAGCAGCCCCAGG + Intergenic
977690397 4:99901502-99901524 GGCCACAGTGAAACAACCACTGG - Intronic
980698795 4:136395645-136395667 GGGCGCAGTGGAGCAGGCGGCGG - Intergenic
983528142 4:168781622-168781644 GACCACAGTGATGCAGGCGCTGG + Intronic
986306651 5:6521487-6521509 GGTCAGGGTGGCGCAGCCGCAGG + Intergenic
986327148 5:6684873-6684895 GAACACAGTGGAGCAGGCACCGG - Intergenic
992021638 5:72630535-72630557 GGCCACAGTGTGGCACCTGCCGG + Intergenic
992050412 5:72935572-72935594 GGGCACCGTGGAGCAGGGGCAGG - Intergenic
997428572 5:133821663-133821685 GGGCACTGTGGAGGAGGCGCAGG + Intergenic
997624052 5:135319699-135319721 GCCCACAGTGGGGCAGATGCAGG + Intronic
1001896476 5:175386412-175386434 GAGCACAGGGGAGCAGCCCCTGG - Intergenic
1002483147 5:179516758-179516780 GGCCACAGCTGAGCATCCCCAGG + Intergenic
1006012410 6:31054037-31054059 GCCCAGAGTCGAGCAGCCACAGG - Intergenic
1006991410 6:38217909-38217931 GGGTACAATGGAGCAGCAGCAGG - Intronic
1007091823 6:39189586-39189608 GGACACAGTGGGCCAGCCCCAGG + Exonic
1010426029 6:75729697-75729719 GGACACAGTGGCCCAGCCTCTGG - Intergenic
1012582060 6:100881321-100881343 GGACAGAGTGGAGCTGGCGCCGG + Exonic
1013367360 6:109446194-109446216 GGCCAAGGCGGAGCAGCTGCGGG + Exonic
1017446315 6:154510203-154510225 GGGCGCAGGGGAGCAGCCGCGGG - Exonic
1019749147 7:2717994-2718016 GGCCATTGTGGAGCCGCCGGGGG - Intronic
1020097315 7:5376350-5376372 GGCCCCTGGGGAGCAGCCGGGGG - Intronic
1020731671 7:11888523-11888545 GGCCAAAGTGGAGGGGCCACAGG - Intergenic
1021880768 7:25093483-25093505 GGCCAAAGTGGAGCAGCTCTTGG + Intergenic
1022794660 7:33722537-33722559 GGTCACACTGGGGCAGCAGCAGG - Intergenic
1023608361 7:41950050-41950072 GGTAGCAGTGGAGCAGCAGCAGG + Intergenic
1023745769 7:43321052-43321074 GGCCACATTGGAGATGCCCCCGG - Intronic
1024794214 7:53003351-53003373 GGACACAGTGAAGAAGCTGCAGG + Intergenic
1026177936 7:68014171-68014193 GACCACAGTGGAGCTGCCCCAGG - Intergenic
1027025887 7:74851414-74851436 GGCCACCGGGGAGCAGCCGATGG + Exonic
1027061872 7:75092696-75092718 GGCCACCGGGGAGCAGCCGATGG - Exonic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1031564409 7:123277545-123277567 AGCCACAGAGCAGCAGGCGCCGG - Intergenic
1032026099 7:128443918-128443940 GGTCACAGTGGCCCAGCCTCCGG + Intergenic
1032708725 7:134444284-134444306 GGCCACAGTGTGGCAGCAGCAGG + Intronic
1033099795 7:138460452-138460474 GGCCTCTGAGGAGCAGCCGCAGG + Exonic
1033214476 7:139483543-139483565 CCCCACGCTGGAGCAGCCGCAGG - Exonic
1040319850 8:46287016-46287038 GGCAACAGTGGGGCAGCAGGCGG - Intergenic
1045098793 8:98825525-98825547 GGCCGCCATGGAGCAGCCGCCGG - Intronic
1045112681 8:98949045-98949067 GGCCACGGTGGACCACCTGCAGG + Exonic
1045547383 8:103140854-103140876 GCCGACAGCCGAGCAGCCGCTGG + Exonic
1049208244 8:141373282-141373304 GGCCTCAGAGGAGCGGCCCCGGG + Intergenic
1051821824 9:21179137-21179159 GGCCACAGTGGCAAAGCGGCAGG + Intergenic
1051823040 9:21191193-21191215 GGCCACAGTGGCAAAGCAGCAGG + Intergenic
1051824868 9:21209728-21209750 GGCCACAGTGGCAAAGCAGCAGG + Intronic
1051826864 9:21231805-21231827 GGCCACAGTGGCAAAGCAGCAGG + Intronic
1052437072 9:28443562-28443584 CTCCACATTGGAGCAGCCACTGG - Intronic
1053077043 9:35141910-35141932 GGCAACAGAGGAGCAGCTCCTGG + Intergenic
1053203756 9:36169739-36169761 GGTCACAGTGGACCAGCTTCTGG + Exonic
1056221122 9:84451528-84451550 GGCAACAGGGGAACAGCCACTGG - Intergenic
1057152724 9:92809015-92809037 AGCCACGGTGCAGCCGCCGCCGG - Intergenic
1057353905 9:94320288-94320310 GGGCAAAGTGGAGCAGCCGCAGG - Exonic
1057487174 9:95494679-95494701 GGCCACACTCCAGCAGCAGCAGG + Intronic
1057653845 9:96937302-96937324 GGGCAAAGTGGAGCAGCCGCAGG + Exonic
1060389802 9:123268236-123268258 GGCCACAATGCCGGAGCCGCGGG + Intronic
1060743488 9:126114558-126114580 GGCCACAGAGGGGCCGCCGTTGG + Intergenic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061228019 9:129292084-129292106 GGACACATGGGAGCAGCCGATGG - Intergenic
1061293999 9:129667222-129667244 GGCCACAGTGGACTGGCCACTGG + Intronic
1061689263 9:132312134-132312156 GCCCACAGCGGAGCAGCCACAGG - Intronic
1061961758 9:133992316-133992338 AGCCAAAGTGCAGCGGCCGCGGG + Intronic
1062082350 9:134630719-134630741 GGCCACAGAGAAGCAGCAGGAGG - Intergenic
1062146166 9:134991065-134991087 GGGCACAGTGGAGCAGGGGGCGG + Intergenic
1062151534 9:135021683-135021705 GGACACCATGGAGCAGCTGCTGG + Intergenic
1062210060 9:135358739-135358761 GGCCACAGAGGGGCTGCCACAGG + Intergenic
1062331747 9:136047948-136047970 GGTCACATTGGAGCAGCAGGGGG + Intronic
1062397936 9:136360007-136360029 AGCCACAGTGGAGGAGCCGACGG + Intronic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1203516714 Un_GL000213v1:8049-8071 GGCCACAGAGCAGCAGCAGGAGG + Intergenic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1188010316 X:25048372-25048394 GGCCACAGTGGAACAGCAAAAGG + Intergenic
1190569838 X:51769946-51769968 GGCCTCAGAGGAGAAGCCTCAGG + Intergenic
1193042141 X:77015175-77015197 GGCAACAGTGCGGCAGCTGCTGG + Intergenic
1200951460 Y:8903089-8903111 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1201059918 Y:10036417-10036439 GGCCAATGTGGAGCGGCAGCAGG + Intergenic
1202109523 Y:21405892-21405914 GGCCAATGTGGAGCGGCAGCAGG + Intergenic
1202161487 Y:21940223-21940245 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202197154 Y:22307699-22307721 GGCCAATGTGGAGCGGCAGCAGG - Intergenic
1202229869 Y:22646150-22646172 GGCCGACGTGGAGCAGCAGCAGG - Intergenic
1202313287 Y:23550015-23550037 GGCCGACGTGGAGCAGCAGCAGG + Intergenic
1202557515 Y:26120579-26120601 GGCCGACGTGGAGCAGCAGCAGG - Intergenic