ID: 923021991

View in Genome Browser
Species Human (GRCh38)
Location 1:230172221-230172243
Sequence CCCCAGTGAATATGAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923021991_923022001 24 Left 923021991 1:230172221-230172243 CCTCTTCCTCATATTCACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 923022001 1:230172268-230172290 ACTTAAGCAGCCCTACTGGATGG 0: 1
1: 0
2: 0
3: 7
4: 98
923021991_923021996 -1 Left 923021991 1:230172221-230172243 CCTCTTCCTCATATTCACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 923021996 1:230172243-230172265 GAAGCCAGCCGCCTCTTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 136
923021991_923022002 25 Left 923021991 1:230172221-230172243 CCTCTTCCTCATATTCACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 923022002 1:230172269-230172291 CTTAAGCAGCCCTACTGGATGGG 0: 1
1: 0
2: 0
3: 8
4: 168
923021991_923022000 20 Left 923021991 1:230172221-230172243 CCTCTTCCTCATATTCACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 923022000 1:230172264-230172286 GGACACTTAAGCAGCCCTACTGG 0: 1
1: 0
2: 4
3: 23
4: 108
923021991_923021994 -5 Left 923021991 1:230172221-230172243 CCTCTTCCTCATATTCACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 923021994 1:230172239-230172261 TGGGGAAGCCAGCCGCCTCTTGG 0: 1
1: 0
2: 1
3: 13
4: 163
923021991_923021995 -4 Left 923021991 1:230172221-230172243 CCTCTTCCTCATATTCACTGGGG 0: 1
1: 0
2: 2
3: 16
4: 201
Right 923021995 1:230172240-230172262 GGGGAAGCCAGCCGCCTCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923021991 Original CRISPR CCCCAGTGAATATGAGGAAG AGG (reversed) Intronic
900214830 1:1475832-1475854 CCCCAGTGACTCTGGGGAGGAGG - Intronic
900222043 1:1514186-1514208 CCCCAGTGACTCTGGGGAGGAGG - Intronic
902206522 1:14872174-14872196 CCCCAGTCAGTATGAAGCAGAGG - Intronic
903456570 1:23491392-23491414 CACCAGTTTAGATGAGGAAGAGG - Intergenic
904255201 1:29250198-29250220 TCCCAGTGAGGGTGAGGAAGAGG - Intronic
904300168 1:29549084-29549106 CCCCAGTGAGGACCAGGAAGAGG - Intergenic
904458107 1:30659193-30659215 CTCCAGTGAGGAGGAGGAAGAGG + Intergenic
905616426 1:39403686-39403708 ACCTAGTAAAAATGAGGAAGAGG - Intronic
907668929 1:56457741-56457763 CCACAGCTAATAGGAGGAAGAGG + Intergenic
908052838 1:60251310-60251332 CCCCAGTCATAATGAGGAATGGG - Intergenic
909193174 1:72580979-72581001 ACCCAGTGAATATTGGGAAAGGG - Intergenic
911602888 1:99866453-99866475 CCCCAGTGGAAATGAGGAAAGGG + Intronic
914457081 1:147846086-147846108 CCCCAGTGAATATAGAGTAGTGG + Intergenic
915228556 1:154429091-154429113 CCTCAGTGATAATGATGAAGTGG - Intronic
918127515 1:181597350-181597372 CCCTGGTGAAGAAGAGGAAGGGG - Intronic
919865727 1:201781545-201781567 TCCCAGTTAATATGAGGTACAGG + Intronic
920448591 1:206039460-206039482 CGGCAGTGAAGATGAGGAAGAGG + Intronic
922057509 1:222055435-222055457 CACCAGTCAATATGTGTAAGAGG - Intergenic
923021991 1:230172221-230172243 CCCCAGTGAATATGAGGAAGAGG - Intronic
1063950599 10:11219239-11219261 CCAGAGTGAATATGATGAATGGG + Intronic
1064030513 10:11880038-11880060 CCCCACTGACTATCAGGGAGGGG - Intergenic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1068625431 10:59241449-59241471 ACCTAGTGAATATGAACAAGAGG - Intronic
1072265265 10:93721136-93721158 TCCCAGTGAAGATGGGAAAGAGG + Intergenic
1072356078 10:94612450-94612472 CACTTGTGAATATGAGGAAAAGG - Intronic
1073243721 10:102074807-102074829 CCCCTGTGAATATTGGGAAAGGG + Intergenic
1076022380 10:127084775-127084797 CTCCAGCAAATGTGAGGAAGAGG + Intronic
1076263494 10:129090900-129090922 TCCCAGGGACTTTGAGGAAGGGG + Intergenic
1076374549 10:129974363-129974385 CCCAAGTGAAGATGACAAAGGGG - Intergenic
1078935949 11:15950316-15950338 ACCCACTGAATCTGAGGAAGGGG - Intergenic
1079203616 11:18395362-18395384 TCCCAGTGAGTAGGAGGCAGAGG + Intronic
1079377707 11:19908388-19908410 TACCAGTGAGGATGAGGAAGAGG - Intronic
1081430870 11:42975232-42975254 CCCAAATGAATATAAAGAAGAGG + Intergenic
1081569369 11:44280055-44280077 CCCCAGTGGGTAGGAGGATGAGG - Intronic
1084227372 11:67725617-67725639 TCCCTGTGGATATTAGGAAGAGG - Intergenic
1084807819 11:71591230-71591252 TCCCTGTGGATATTAGGAAGAGG + Intronic
1084844936 11:71891249-71891271 TCCCTGTGGATATTAGGAAGAGG + Intronic
1086115821 11:83248894-83248916 ACCCAGAGAAACTGAGGAAGTGG - Exonic
1086148655 11:83583470-83583492 CCCCAGAGAATAAAAGGAAGAGG - Intronic
1087116284 11:94528558-94528580 TCCCAGTGGAAATGAGGAAAGGG + Intergenic
1087297368 11:96392026-96392048 ATCCAGTGAAAATGAGGAGGAGG + Exonic
1089792891 11:120957146-120957168 CCCCAGAGAGTAAGGGGAAGGGG - Intronic
1089926898 11:122268227-122268249 CCTCAGACAATATGAGGAATGGG - Intergenic
1090768354 11:129896136-129896158 ACCCAGTGAATAACAGGAAAGGG - Intergenic
1090862057 11:130662877-130662899 ACCCAGTGTATATAAGGATGTGG + Intergenic
1091237338 11:134031100-134031122 CCCCAGTGTTCATAAGGAAGAGG + Intergenic
1091990859 12:4954808-4954830 CCCAAATAAAGATGAGGAAGTGG + Intergenic
1092432049 12:8417865-8417887 TCCCTGTGGATATTAGGAAGAGG - Intergenic
1097601820 12:61702559-61702581 GCACAGTGTATATGAAGAAGTGG + Intergenic
1098945969 12:76589940-76589962 TCCCAGTGAATAGGAGTGAGGGG + Intergenic
1102729788 12:115098470-115098492 CCCCAGAGAATATGTGAAGGTGG + Intergenic
1103256184 12:119543417-119543439 TCCCAGTGGACATGAGGGAGGGG + Intergenic
1103896692 12:124277943-124277965 CCCCAGTGAAGAAGAGGAGGAGG - Intronic
1104070790 12:125343530-125343552 CCTCAGGTAATATGAGAAAGTGG + Intronic
1107720378 13:43242326-43242348 GCCCAGTGAATGTAAAGAAGAGG + Intronic
1113065220 13:106366877-106366899 CCCCAGAGTAGATGAGAAAGTGG + Intergenic
1115539736 14:34409568-34409590 CCCCAGTGAACATAAGGACTAGG + Intronic
1119857079 14:77908839-77908861 CCCCAGGGAGAGTGAGGAAGAGG + Intronic
1125644346 15:41259379-41259401 ACAGAGTGCATATGAGGAAGTGG + Intronic
1125676960 15:41507274-41507296 CCCCAGTGAAGCAGAAGAAGTGG - Exonic
1126867373 15:52951018-52951040 CCCCTCTGAATATGAGTGAGTGG + Intergenic
1128955110 15:71932618-71932640 CCCCAGTTAATTTCTGGAAGGGG - Intronic
1129922833 15:79334890-79334912 TCTCAGGGAATATGTGGAAGAGG + Intronic
1131205463 15:90442128-90442150 CCCCAGAGAATCTGGGAAAGAGG - Intronic
1134127424 16:11625918-11625940 CCCCAGTGCCCATGAGGAAATGG + Intronic
1137071849 16:35910527-35910549 CCCAAGTGAGGATGGGGAAGAGG + Intergenic
1137514608 16:49132355-49132377 CCCCAGGGAATATGAGGATGAGG + Intergenic
1138451090 16:57093655-57093677 CCCCAGTACATATGGGGCAGGGG - Intronic
1139877378 16:70157071-70157093 CCAGAGTGAATATTAGGAGGAGG - Exonic
1140917867 16:79509708-79509730 CCCCAGAGAAATTGAGGGAGAGG - Intergenic
1141158723 16:81614540-81614562 CCCCAGTGGAAATGTGGCAGTGG + Intronic
1141634511 16:85306913-85306935 CCCCAGTGCATAACAGGAAGGGG - Intergenic
1142304575 16:89278301-89278323 CCCCAGTGGGTAGGAGGAGGTGG + Intronic
1142305449 16:89281889-89281911 ACCCAGTGAAGATGAGCAACGGG - Exonic
1143004346 17:3818528-3818550 ACCCATTGAAGAGGAGGAAGAGG - Exonic
1144110096 17:12021947-12021969 CCCCAGTAAATTTAAGGAAATGG - Intronic
1147917122 17:43895058-43895080 ATGCAGTGAAAATGAGGAAGGGG + Intronic
1148242628 17:46010591-46010613 CCTCCTAGAATATGAGGAAGGGG - Intronic
1150631038 17:66880594-66880616 ACCCAATGAACATGAAGAAGAGG - Exonic
1151585338 17:75005083-75005105 CCCCAGTGAAGGGGAGGCAGGGG - Exonic
1151868317 17:76819763-76819785 CCCCAGTGAAGTGGGGGAAGAGG - Intergenic
1152113391 17:78369888-78369910 CCACAGTGAAGTAGAGGAAGAGG - Intergenic
1152191067 17:78887941-78887963 CTGCAGTGAAAATGAGTAAGAGG + Intronic
1154946554 18:21167411-21167433 CCACAGAGACTATGGGGAAGAGG - Intergenic
1155094633 18:22543969-22543991 CCCCAGGGGATGTGAGGAACAGG - Intergenic
1155222335 18:23697009-23697031 CCTGACTAAATATGAGGAAGAGG + Intronic
1156373310 18:36490424-36490446 CCTCAGTAAAGATGAGGATGGGG + Intronic
1157155593 18:45262426-45262448 CCGCAGGGATTCTGAGGAAGGGG + Intronic
1157392409 18:47313883-47313905 CAGCAGTGAATATGAGGATGGGG - Intergenic
1157966197 18:52211092-52211114 GCCCAGTGTATTTGAGGAACTGG + Intergenic
1159398833 18:67903047-67903069 CTCCAGTTAATATGAATAAGAGG + Intergenic
1159810068 18:73007733-73007755 CCCCAGTGAACAAGAGGAATAGG + Intergenic
1159816464 18:73080007-73080029 CCCCACTGAATATTTGTAAGTGG + Intergenic
1160871527 19:1279995-1280017 CCCCAGTGGATGTGAGGACACGG - Intergenic
1161310214 19:3589830-3589852 GCCCAGTGAGTTTGAGGAGGAGG + Exonic
1161858287 19:6778406-6778428 CCCCAGTGAATAGTGGGGAGAGG + Intronic
1162869223 19:13573012-13573034 CACCAGGGTATATGAGCAAGGGG - Intronic
1163324532 19:16594632-16594654 CCACGGTGAAGATGAAGAAGGGG + Intronic
1163431204 19:17268830-17268852 CCCCACTGAAGAGGAGGAGGAGG + Exonic
1163830840 19:19546515-19546537 GCCCAGTGAAAAGGAGGAAGGGG + Exonic
1164677521 19:30111754-30111776 CCTCAGTGCAAAAGAGGAAGGGG - Intergenic
1164821812 19:31256514-31256536 CCCCAGGGCATATGAGGCAGAGG + Intergenic
1165144481 19:33722610-33722632 CCCCAGGGAAGAGGGGGAAGGGG - Intronic
1166219438 19:41355076-41355098 CTCCAGTGAGTATCAGGGAGTGG - Intronic
1166941063 19:46366089-46366111 CCCCAGTGAACCTGTGGAATTGG + Intronic
1167041666 19:47026457-47026479 GCCCAGTGAGGATGAGGACGTGG + Intronic
1168119910 19:54246083-54246105 CCTCAGTGAGTAAGAGGAAGAGG - Intronic
1168231295 19:55033578-55033600 CCTCAGTGGATGTGAGGAATGGG + Intronic
926240379 2:11080720-11080742 CCCCAGTGATCATGATGAGGAGG - Intergenic
929047369 2:37803010-37803032 CCACAGTGGAGATGAGTAAGAGG + Intergenic
929279362 2:40061268-40061290 CCCCAGGGCATGTGAGGAGGAGG - Intergenic
929749152 2:44691802-44691824 GCCCAGGGACTATGAGGCAGAGG - Intronic
930153324 2:48079956-48079978 GCCCAGTGAGTATCAGGAATTGG - Intergenic
931184800 2:59939627-59939649 CCTCAGTGACTCTGAGGAAGTGG - Intergenic
932311192 2:70743199-70743221 CCTCAGTGGACATGAGGAATAGG + Intronic
934942948 2:98515625-98515647 CCCCAGTGAATAAGCAAAAGTGG + Intronic
935139323 2:100338735-100338757 CACCAGTGAATTTTAGGGAGTGG - Intergenic
935276672 2:101481173-101481195 CCCCAGGGTCTATGGGGAAGAGG - Intergenic
935444284 2:103139822-103139844 CTCTAGTGGAGATGAGGAAGTGG - Intergenic
935681880 2:105645281-105645303 ACCCAGTGAATCAGAGGGAGAGG + Intergenic
939125637 2:138174240-138174262 CCTCAGTGAGGATGAGGAATGGG + Intergenic
939599163 2:144166939-144166961 CCCCAGAGAATAGGATGGAGTGG - Intronic
942956209 2:181776519-181776541 CCCCAGTGAATGAGAGGAAGAGG + Intergenic
943405711 2:187481486-187481508 CCCCAGCCAAGATGCGGAAGTGG - Intronic
943471066 2:188293512-188293534 ACAGAGTGAATGTGAGGAAGTGG + Intronic
946348008 2:219126830-219126852 CCCAAGTGAAAAGGTGGAAGGGG + Intronic
1169714662 20:8601624-8601646 CCCTTGTGTAGATGAGGAAGTGG + Intronic
1170934278 20:20796292-20796314 CCACCTTGAATATGGGGAAGGGG - Intergenic
1185286629 22:50003221-50003243 CCCAAGAGAATTTGAGGGAGTGG + Intronic
950333828 3:12178108-12178130 CCCCAGGGAGAATGAGGCAGCGG - Intronic
952791331 3:37202979-37203001 ACCCAGTGAGTCTGAGGAAATGG + Intergenic
953151789 3:40331669-40331691 CCCAAGGGAATAGGAGGAATGGG + Intergenic
953990348 3:47478428-47478450 CCCCATGGAATATAATGAAGTGG + Intergenic
954127269 3:48538917-48538939 CCCCAGTTTATCTGAGGAATGGG - Intronic
954595279 3:51819099-51819121 CCCCAGTGGGTGAGAGGAAGTGG - Intronic
954959241 3:54549957-54549979 CCTGAGTGAATATCAGGAATCGG + Intronic
955225626 3:57058012-57058034 GCCCAGTCAATATGAGGAAAAGG - Intronic
955402479 3:58602982-58603004 CCCCAGTGATTATAAACAAGTGG + Intronic
960219358 3:115086673-115086695 CCCCAGAGAAAATCAGGTAGAGG - Intronic
963914212 3:150842563-150842585 CCCCAGTGACTCTGGGGAAATGG - Intergenic
965680191 3:171242321-171242343 CACAATTGAAAATGAGGAAGAGG - Intronic
968964340 4:3761929-3761951 CCCCAGGAAAGATGAGGCAGAGG + Intergenic
969499721 4:7545358-7545380 CCCCAGAGCACTTGAGGAAGAGG - Intronic
969860899 4:10034596-10034618 CCACAGTGAACAAGGGGAAGAGG - Intronic
969964788 4:10983062-10983084 CATGAGTGAACATGAGGAAGGGG + Intergenic
972191768 4:36601484-36601506 CAGCAGAGAAGATGAGGAAGTGG + Intergenic
973539785 4:51924471-51924493 CCCCTGGAAATATGGGGAAGAGG - Intergenic
974688714 4:65267357-65267379 CCACAGTGAAGGTAAGGAAGAGG + Intergenic
976380827 4:84396408-84396430 TACCAGGGAATGTGAGGAAGAGG - Intergenic
976765923 4:88597485-88597507 CTCCAGTGAAGATGAAGATGTGG - Intronic
976865032 4:89714878-89714900 CACCAGTGAAGATGAGAAAATGG + Intergenic
979282040 4:118879382-118879404 CCCCAGTGTATATTTGGAAGTGG + Intronic
981670151 4:147277347-147277369 CCTCAGTAATGATGAGGAAGAGG + Intergenic
982794858 4:159632195-159632217 CCACAGTGAATAAGAGTCAGTGG - Intergenic
986983709 5:13477172-13477194 CCCAAGTGAAGATGAAGAGGGGG - Intergenic
987083846 5:14450398-14450420 CCCCACTGAATTTGTGGGAGGGG + Intronic
990031247 5:51262221-51262243 CACCAGTAAATATGAAGAAAAGG - Intergenic
995765759 5:115616608-115616630 TCCCAGTGAAAATGAGCAGGGGG - Intronic
997039983 5:130241648-130241670 AGCCAGTGATTGTGAGGAAGAGG + Intergenic
999001472 5:147928327-147928349 ACCCAGAAAATTTGAGGAAGAGG - Intergenic
999208901 5:149870673-149870695 CCCCAGTGCATATAAGGGGGAGG - Intronic
1000209690 5:159098026-159098048 CCCCACTGAGTATTAGGATGGGG - Intronic
1003398063 6:5770165-5770187 TTCCAGTGAATATGTGGGAGTGG + Intronic
1003815853 6:9839532-9839554 CCCAAGAGAAAATGAAGAAGAGG - Intronic
1004020879 6:11774803-11774825 TCCCAGAGAATATGAGCTAGGGG - Intronic
1006612201 6:35300919-35300941 CCCCACTGACTATCAGGCAGTGG + Intronic
1006817449 6:36862065-36862087 CCACAGTGACTAAGAGGAGGAGG - Intronic
1008332488 6:50260839-50260861 CCCCAGTGATTCTGAGGTAATGG - Intergenic
1008554245 6:52659396-52659418 CCTCAGTCAGTATGAGGGAGAGG + Intergenic
1008867144 6:56226402-56226424 CCTCTGGGATTATGAGGAAGAGG - Intronic
1010487980 6:76438445-76438467 GCCCAGTGAATCTGAGGAGCTGG + Intergenic
1011842532 6:91519548-91519570 CCCAAGTGAAAATGTGGGAGTGG - Intergenic
1014078070 6:117259766-117259788 CCCCTGTGTGTATGAGGGAGTGG - Intergenic
1014346034 6:120270620-120270642 TCCCAGAGAATAGAAGGAAGTGG + Intergenic
1015519234 6:134114641-134114663 CCCCTGTGAAAATGGGGTAGGGG + Intergenic
1015526468 6:134178581-134178603 CACCAGGGAGTATGAGGAAAGGG - Intronic
1017078523 6:150643093-150643115 TACCAAGGAATATGAGGAAGAGG + Intronic
1018217600 6:161545271-161545293 CTCCAGTGATTATCAGGATGTGG - Intronic
1018657929 6:166057767-166057789 CATGAGGGAATATGAGGAAGTGG - Intergenic
1019477961 7:1253040-1253062 CCCCTGTGAAGATGAGGAGTGGG - Intergenic
1020311151 7:6869808-6869830 TCCCTGTGGATATTAGGAAGAGG - Intergenic
1020700157 7:11471578-11471600 CCCCAGTGTTTATTTGGAAGTGG + Intronic
1022255468 7:28652719-28652741 CCCAGGTGAATATGTGTAAGAGG - Intronic
1022320823 7:29286225-29286247 CCCAAGGGAATCTGAGTAAGGGG - Intronic
1023039357 7:36158920-36158942 CCACAGGGAAAATGAGCAAGTGG - Intronic
1024999956 7:55307494-55307516 CTCCAGTGAAAGTGTGGAAGAGG + Intergenic
1029891453 7:103934303-103934325 TCTCATTGAATATGAGGAAGTGG - Intronic
1030167282 7:106567942-106567964 CACTAGTGAATATGAGCATGTGG + Intergenic
1030303848 7:108001170-108001192 CCCAAGTGAAGATGCGGTAGAGG + Intronic
1030646820 7:112070822-112070844 CTCCAGGGAATAGGAGGAGGAGG - Intronic
1030762505 7:113368938-113368960 TGCCAGTGAATATGAACAAGGGG - Intergenic
1032283340 7:130523711-130523733 GCCCAGTGACTCAGAGGAAGTGG + Intronic
1032284082 7:130527936-130527958 GCCCAGTGACTCAGAGGAAGTGG + Intronic
1033194042 7:139311505-139311527 CCCCTGTGCAGATGAGGAAATGG - Intergenic
1033485593 7:141785928-141785950 CCTCACAAAATATGAGGAAGAGG - Intronic
1034409347 7:150931473-150931495 CCACAGTGAACAGGAGGAAAGGG - Intergenic
1034580328 7:152035840-152035862 CCCAAGTGAGGATGGGGAAGGGG + Intronic
1042614752 8:70635760-70635782 TACCAGGGAATAGGAGGAAGGGG - Intronic
1047115233 8:121834448-121834470 CCACTGTGATTGTGAGGAAGAGG + Intergenic
1048429560 8:134357615-134357637 CACCAGGGAATCTGGGGAAGAGG - Intergenic
1049722651 8:144126733-144126755 CCCCATGGAAACTGAGGAAGAGG - Intergenic
1050082098 9:1926472-1926494 CCCCAGAGAACATTTGGAAGTGG - Intergenic
1052692859 9:31837115-31837137 TCCTAGGGAATAAGAGGAAGTGG - Intergenic
1054910512 9:70451202-70451224 CACCAGTGAATCTGAGGTCGGGG + Intergenic
1059024465 9:110610722-110610744 GCACAATGAATATCAGGAAGCGG - Intergenic
1059376384 9:113884861-113884883 CCTCAGTGAACAAGCGGAAGTGG + Intronic
1060861330 9:126957180-126957202 ACCCAGTGAAGCTGAAGAAGTGG + Intronic
1062320710 9:135989363-135989385 CCCCAGTGGATGTGAGGAGCTGG - Intergenic
1062445107 9:136590332-136590354 CCACAGTGACCATGAGGACGTGG + Intergenic
1185930305 X:4195563-4195585 CCCCAGTGTACATGAGGCAAAGG + Intergenic
1186139316 X:6554360-6554382 CTCCAGTATATATGAGGAAAAGG + Intergenic
1188220497 X:27535615-27535637 CTCCGAAGAATATGAGGAAGAGG - Intergenic
1188946339 X:36308034-36308056 CCCCAATAATTATGATGAAGGGG - Intronic
1190737782 X:53267048-53267070 CCCCAGGGAAGAGGAGGAGGAGG - Intronic
1195365229 X:104117881-104117903 CTCCAGTGAAAAGGAGGATGGGG - Intronic
1195569173 X:106380082-106380104 CCCCATTGAATAAGAGGTAGAGG + Intergenic
1197568858 X:128123437-128123459 TCCCAGTGAATTACAGGAAGAGG - Intergenic
1197765783 X:130058709-130058731 CACCAGTGACTGAGAGGAAGAGG + Intergenic
1199733270 X:150658710-150658732 CCCCAGTGATTCTCATGAAGGGG + Intronic
1201710129 Y:16982186-16982208 CCTCAGTGAACATGAGGCAAAGG + Intergenic