ID: 923022513

View in Genome Browser
Species Human (GRCh38)
Location 1:230175667-230175689
Sequence CCTCCCCCTCCTTCTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 900
Summary {0: 1, 1: 0, 2: 9, 3: 87, 4: 803}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923022501_923022513 4 Left 923022501 1:230175640-230175662 CCCTCTCCCCCTCCTCCTCCTCA 0: 1
1: 32
2: 617
3: 5163
4: 14730
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022494_923022513 25 Left 923022494 1:230175619-230175641 CCTCTCCCCTCCTCCTCCTTTCC 0: 1
1: 13
2: 227
3: 1405
4: 6593
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022498_923022513 15 Left 923022498 1:230175629-230175651 CCTCCTCCTTTCCCTCTCCCCCT 0: 2
1: 10
2: 95
3: 1060
4: 7684
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022506_923022513 -5 Left 923022506 1:230175649-230175671 CCTCCTCCTCCTCACTGTCCTCC 0: 2
1: 8
2: 77
3: 963
4: 6844
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022491_923022513 30 Left 923022491 1:230175614-230175636 CCCTCCCTCTCCCCTCCTCCTCC 0: 2
1: 29
2: 314
3: 1734
4: 9260
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022507_923022513 -8 Left 923022507 1:230175652-230175674 CCTCCTCCTCACTGTCCTCCCCC 0: 1
1: 2
2: 30
3: 384
4: 3025
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022492_923022513 29 Left 923022492 1:230175615-230175637 CCTCCCTCTCCCCTCCTCCTCCT 0: 3
1: 22
2: 274
3: 1589
4: 7629
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022495_923022513 20 Left 923022495 1:230175624-230175646 CCCCTCCTCCTCCTTTCCCTCTC 0: 2
1: 9
2: 93
3: 818
4: 5185
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022496_923022513 19 Left 923022496 1:230175625-230175647 CCCTCCTCCTCCTTTCCCTCTCC 0: 2
1: 9
2: 79
3: 1090
4: 5892
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022500_923022513 9 Left 923022500 1:230175635-230175657 CCTTTCCCTCTCCCCCTCCTCCT 0: 1
1: 21
2: 307
3: 1886
4: 9761
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022493_923022513 26 Left 923022493 1:230175618-230175640 CCCTCTCCCCTCCTCCTCCTTTC 0: 1
1: 8
2: 105
3: 721
4: 4233
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022497_923022513 18 Left 923022497 1:230175626-230175648 CCTCCTCCTCCTTTCCCTCTCCC 0: 2
1: 20
2: 254
3: 1688
4: 8120
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022499_923022513 12 Left 923022499 1:230175632-230175654 CCTCCTTTCCCTCTCCCCCTCCT 0: 3
1: 6
2: 95
3: 1017
4: 6467
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022505_923022513 -4 Left 923022505 1:230175648-230175670 CCCTCCTCCTCCTCACTGTCCTC 0: 1
1: 3
2: 27
3: 361
4: 2494
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022504_923022513 -3 Left 923022504 1:230175647-230175669 CCCCTCCTCCTCCTCACTGTCCT 0: 2
1: 2
2: 29
3: 343
4: 2104
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022503_923022513 -2 Left 923022503 1:230175646-230175668 CCCCCTCCTCCTCCTCACTGTCC 0: 3
1: 11
2: 77
3: 1073
4: 7822
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803
923022502_923022513 3 Left 923022502 1:230175641-230175663 CCTCTCCCCCTCCTCCTCCTCAC 0: 1
1: 24
2: 161
3: 1428
4: 6795
Right 923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG 0: 1
1: 0
2: 9
3: 87
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923022513 Original CRISPR CCTCCCCCTCCTTCTCCTTG GGG Intronic
900100509 1:960275-960297 CCTCCTCCTCCTCCTCCTCCGGG - Intergenic
900206668 1:1434638-1434660 CCTTCCCCACCCTCTCCTGGAGG - Intergenic
900365272 1:2309669-2309691 CCCCCACCTCCTCCTCCCTGTGG + Exonic
900393407 1:2443495-2443517 CCTCCCCCTCCGCCTCCCTCCGG - Intronic
900459672 1:2796869-2796891 CCTGCCCCACCCTCTCGTTGGGG + Intronic
900800425 1:4733731-4733753 CCCTCCCCTTGTTCTCCTTGTGG + Intronic
901034363 1:6327386-6327408 CCTCCTCCTCCTGCTCCTGCCGG + Exonic
901202262 1:7473411-7473433 TGTCCTCCTCCTCCTCCTTGGGG - Intronic
901221344 1:7585687-7585709 CATTCCCCTCCTGCCCCTTGAGG - Intronic
901362606 1:8715568-8715590 CTTCCTCTTCCTTCTCATTGTGG - Intronic
901436348 1:9249457-9249479 CCTCTCCCTCCTGGACCTTGAGG - Intronic
901800207 1:11704147-11704169 CCACCTCCTCCTTGTCCTGGGGG - Intronic
902716491 1:18276346-18276368 GGTCCCCCTCCTTCTCCAGGTGG + Intronic
903034898 1:20486785-20486807 TCTCCCCCTCCCCCTCCTGGAGG - Intergenic
903352309 1:22725024-22725046 CCTCCCCCTTCTGCTCTTGGTGG + Intronic
903516724 1:23916160-23916182 CCTCACCCTTCTTCCCCATGTGG - Intergenic
903770148 1:25758718-25758740 CCTCCCCACCCTTCTTCCTGCGG + Intronic
904025050 1:27497350-27497372 CCTCCTCCTCCTCCTCCTTCAGG + Intergenic
904041882 1:27590104-27590126 CGGGCCCCTCCTTCTCCTGGAGG + Intronic
904291696 1:29490389-29490411 CCACCTCCTCCTTCCCCTAGAGG - Intergenic
904376680 1:30086166-30086188 CCTCCGCCACCTCCTCCTGGTGG - Intergenic
904578765 1:31524055-31524077 CCTCCGCCTCCTTCTCATGTGGG - Intergenic
905004403 1:34698317-34698339 CCTGCCCCTCCAACTCCCTGGGG - Intergenic
905300961 1:36985927-36985949 CCTCCCCCTCCTCCTCACTGTGG + Intronic
905401800 1:37708975-37708997 CCTCCTCCTCCTCCTCCTGTGGG + Exonic
905680694 1:39869088-39869110 CCTCCCCCTCCCTCTCCCCATGG + Intronic
905956361 1:42000501-42000523 CATCCTCCTCTTTCTCCTTTGGG - Intronic
906325614 1:44843442-44843464 CCCCTCCCTCCTCCTCCCTGGGG - Intergenic
906528649 1:46511000-46511022 CCTCAGCCTCCTTCTGCTTCTGG - Exonic
907596701 1:55726931-55726953 CATCTCCCTCATTCTCCTTGTGG + Intergenic
909712635 1:78669575-78669597 CCTCCCCTTCCTACTCTCTGAGG - Intergenic
911641914 1:100298573-100298595 CCCCCCTCCCCTTCTCCTTTAGG - Intergenic
911876718 1:103174714-103174736 CCTCCCCATCATTCTCATTGTGG - Intergenic
912382427 1:109254676-109254698 CATACCCCTCCTTCCCCTTCAGG - Intronic
912462981 1:109849425-109849447 CCTCACCCACCTTCTCCCTTGGG + Intergenic
912535431 1:110365292-110365314 CCTCCCCCACCTTTTTCTTCTGG + Intronic
912891885 1:113542108-113542130 TCCCCCCCTCCTTATTCTTGGGG + Intronic
913129764 1:115828798-115828820 CCTCCCCCACCTTCTCCCAGAGG + Intergenic
913306392 1:117431184-117431206 CCTCCCCCTCCCTCTCCCCACGG - Intronic
914742075 1:150473092-150473114 CCCCCACCTCCTCCTCCATGGGG - Exonic
914780411 1:150780867-150780889 CCTCCCCCTCCCTCTCCCCACGG + Intergenic
914979819 1:152404219-152404241 CCACCCCCTCCATCTCCTGTAGG - Intergenic
915332350 1:155120945-155120967 GCTCCCACTCCTTCTTCTTGGGG + Intergenic
916419877 1:164627035-164627057 CCTCCTCCTGCATCTCCTTTTGG + Intronic
916575122 1:166060168-166060190 CTTCCTCCTCCTTCTCCATGTGG - Intronic
916614200 1:166422850-166422872 CCTCCCACTCCATCCCCTTCTGG + Intergenic
916771221 1:167910541-167910563 ACTTCCCTACCTTCTCCTTGAGG + Intronic
917517780 1:175722213-175722235 CCTCCTCCTCCTTCCCCTATCGG + Intronic
917738917 1:177944847-177944869 CCTCTCCCTCTCCCTCCTTGAGG + Intronic
918215479 1:182389860-182389882 CCTCACCACCCTTCCCCTTGGGG + Intronic
918932832 1:190878491-190878513 CCTCGCCCACCTTCTCACTGAGG - Intergenic
919471102 1:197980147-197980169 CCTCCTACTCCTTCTCCTTCTGG + Intergenic
919906930 1:202084905-202084927 CCTCCTCCTCCTCCACCTTGTGG - Intergenic
920097536 1:203496332-203496354 CCTCCACCTCTTTCTCTGTGAGG + Intronic
920365320 1:205445185-205445207 CCTCCCTCTCCCTCTCCCTCTGG + Intronic
920609123 1:207420450-207420472 CTTCCCTCTCCTTATCTTTGAGG - Intergenic
920920749 1:210295396-210295418 CTTCCTCCACCTCCTCCTTGGGG + Intergenic
921192108 1:212719613-212719635 CCTCCCTCCCCTACTCCTTTTGG + Intergenic
922596397 1:226816903-226816925 GGTCCTCCTCCTTCTCTTTGTGG - Intergenic
922773931 1:228206534-228206556 CCTCACCCTCCTTCTGATTGAGG + Intronic
922901319 1:229138905-229138927 CCTCCCCTTCCCTCTCCTCTGGG + Intergenic
923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG + Intronic
923209083 1:231786973-231786995 CCTGATCCTCCTTATCCTTGAGG - Intronic
923839117 1:237648547-237648569 CTTCCTCCTCCATCTTCTTGAGG + Exonic
924436689 1:244048923-244048945 CCTCCTCCTCCTCCTCCTCCCGG - Intronic
924458058 1:244233960-244233982 CCTCTTCCTCCTCCTCCTTTGGG - Intergenic
1062843989 10:690450-690472 TCCCACCGTCCTTCTCCTTGTGG + Intergenic
1062925757 10:1314448-1314470 CCTCCTCCTCCTCCTCCTCCTGG + Intronic
1062982497 10:1737064-1737086 CCTCCGCCTCCTCCTCCTCTTGG + Exonic
1063036121 10:2288532-2288554 CCTCTCCCTCCCTCTCCACGCGG - Intergenic
1063924713 10:10966495-10966517 CCTCTCCCACCTTCTCCTCTGGG + Intergenic
1064324609 10:14338354-14338376 CCACTCCCTGCTTCCCCTTGTGG - Intronic
1064397252 10:14991881-14991903 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1064400148 10:15014350-15014372 CCTGCACCTCTCTCTCCTTGCGG + Intergenic
1064962199 10:20977557-20977579 CCTCCTCCTCCTCCTCCTGTGGG - Intronic
1064975754 10:21113017-21113039 TCTCCTCCTCCTTCTTCTTCAGG - Intronic
1065297343 10:24289516-24289538 CCTCCTCCTCCTCCTCCATGAGG - Intronic
1066390373 10:34973278-34973300 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1066474186 10:35728706-35728728 CCTCTCCCTCTTTCTTCTTTAGG - Intergenic
1067058817 10:43067432-43067454 CCCCCTCCTTCTTCTCCTAGGGG - Intergenic
1067289510 10:44931100-44931122 CCTCCTCTTACTTCTCCATGTGG - Intronic
1067465381 10:46494451-46494473 CCTCCCTCTCCTTCTCTCTTGGG - Intergenic
1067621806 10:47890150-47890172 CCTCCCTCTCCTTCTCTCTTGGG + Intergenic
1067941471 10:50660351-50660373 CCTCCTCCACCTTCTCCACGGGG - Intergenic
1069711959 10:70495340-70495362 CCTCCCTCTCCTTCTCTTGTTGG + Intronic
1069794832 10:71045387-71045409 CCTCCCACTCCTCCTCCTTCGGG + Intergenic
1069874139 10:71551384-71551406 CCCCTCCCTCCTTCTCCTCCTGG - Intronic
1070093328 10:73311301-73311323 CCTCTCCCTCCATCTTCTTATGG + Intronic
1070735288 10:78859755-78859777 CCTCCCGCTACCTCTTCTTGGGG + Intergenic
1070850354 10:79558142-79558164 CCTGCCCCTCCTTCTGTGTGGGG - Intronic
1070856864 10:79613154-79613176 CCTGCCCCTCCTTCTGTGTGGGG + Intronic
1070862707 10:79685313-79685335 CCTCCTCCACCTTCTCCACGGGG - Intergenic
1071573706 10:86711462-86711484 CCTCCACCTCCCTCTCCGGGAGG + Intronic
1072218864 10:93310595-93310617 CGTCGGCCTCCTTCTCGTTGAGG + Exonic
1072673920 10:97451720-97451742 CCTCCGCCTCCTTCTGCTGCTGG + Exonic
1073054028 10:100687524-100687546 CCTCCCACTTCCTCTGCTTGGGG - Intergenic
1073099767 10:101000355-101000377 CTTGCCCCTCCTTCTCTTTCGGG + Exonic
1073121284 10:101123761-101123783 CCTCCCACTCCTTCCCCGCGAGG + Intronic
1073435989 10:103516382-103516404 CAACCCCCGCCTTCTGCTTGGGG - Intronic
1073452702 10:103619034-103619056 CATCACCCTCCTTCTGCTTTTGG - Intronic
1074096520 10:110318172-110318194 CCTCCCCATCCATCTCGCTGAGG + Intergenic
1074160946 10:110835897-110835919 CTGCCCCCTCGGTCTCCTTGAGG - Exonic
1074207243 10:111293865-111293887 CCCACCCCTCCCTCTCATTGTGG + Intergenic
1074717504 10:116233570-116233592 CCTCCCCAACACTCTCCTTGTGG + Intronic
1074722294 10:116273246-116273268 CCGCCCCCTCCTTCCCTTTCCGG + Exonic
1075009308 10:118854008-118854030 CCTCCTCCTCCTGCTGTTTGCGG - Intergenic
1075112219 10:119596638-119596660 CCTCCTCCTCCTGCTCCTCCTGG - Intronic
1075189661 10:120295162-120295184 CCTCCTGATCCTTCCCCTTGAGG + Intergenic
1075979177 10:126722393-126722415 CCTTCCCCTCCATCACCTTCAGG + Intergenic
1076054468 10:127360352-127360374 CCTCCCCCTCCTGCTAGTTGTGG - Intronic
1076217080 10:128703722-128703744 TCTACCCCTCCGTCTCCTTAGGG + Intergenic
1077368214 11:2169805-2169827 CCGCCGCCTCCCGCTCCTTGCGG + Exonic
1077571944 11:3346553-3346575 CCTCCACCTCCTCCTCCTCCAGG - Intronic
1077814578 11:5674479-5674501 TTTTCCCCTCTTTCTCCTTGTGG - Intronic
1078105881 11:8357681-8357703 CTTCCCCAGCCTTCTCCTAGTGG - Intergenic
1078340680 11:10496276-10496298 CCCCCGCCTTCTTCTCATTGTGG + Intronic
1078976544 11:16484503-16484525 CCTCCACCTCATTCTCATTCTGG + Intronic
1079251012 11:18788009-18788031 CCTCCCACTCCTCCTCCTATTGG + Intronic
1079251318 11:18790258-18790280 TCCCCACCTCTTTCTCCTTGGGG - Intronic
1079454690 11:20626382-20626404 CCCCTCCCTCCTTCTCTCTGTGG + Intronic
1079691745 11:23427088-23427110 CCTCCTCCTCCACCTCCTTCTGG + Intergenic
1080583622 11:33663268-33663290 CCTCCCAATCCTTCTCCATCTGG - Intronic
1080607480 11:33875697-33875719 CTTCCCCCACCTTCTCCTTTGGG + Intronic
1080784660 11:35463661-35463683 CGGCCCCCTCCTCCGCCTTGAGG - Intronic
1080859630 11:36142079-36142101 CCTCCCCCTTCTTCACTTTTGGG + Intronic
1081735432 11:45400195-45400217 CTTTCCCCTCATCCTCCTTGAGG - Intergenic
1083042103 11:59699032-59699054 CCTCCCCCTCCCTCTCCCCACGG + Intergenic
1083187698 11:61027033-61027055 CCTCCCCCTCCTTCTGCACTTGG - Intergenic
1083270474 11:61569756-61569778 TCTCCTCCCCCTTCTCCCTGGGG - Intronic
1083297871 11:61724933-61724955 TGTTGCCCTCCTTCTCCTTGTGG + Intronic
1083428029 11:62599292-62599314 CAACCCCCCCCTTCTCCCTGAGG - Intronic
1083668055 11:64285932-64285954 CCGCCTCCTCCCTCCCCTTGAGG + Intronic
1083680946 11:64351654-64351676 CTGCCCCCTCCTGCTCCTTTTGG + Intronic
1083782822 11:64926800-64926822 GCTTCACCTCCTTCCCCTTGAGG - Exonic
1083844242 11:65321676-65321698 CCTCTCCCTCCCTCTCCACGTGG + Exonic
1084104865 11:66974962-66974984 CCTTCTCCTCCTTCTCCTCTAGG - Intergenic
1084177944 11:67433228-67433250 CCTGCCCCTCCTCCTCCCCGGGG - Intronic
1084213337 11:67633936-67633958 CCTTGTCCTCCCTCTCCTTGCGG + Intronic
1084261147 11:67979547-67979569 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1084412631 11:69013287-69013309 CCTCCCCCTCCCCCTCCTGCCGG - Exonic
1084413585 11:69017729-69017751 CCACCTCCTCCTTCTCCTTCAGG - Intergenic
1084472658 11:69372242-69372264 CCTGCCCAGCCTCCTCCTTGGGG + Intergenic
1084673219 11:70619729-70619751 CATCTCCCTCATTCTCTTTGGGG + Intronic
1084807490 11:71589007-71589029 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1084847433 11:71911470-71911492 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1085056150 11:73405173-73405195 CCACCTGCTCCTTCTCCTGGAGG + Intronic
1085112231 11:73898187-73898209 CCTCCCCCTCCCTCTCCCCACGG - Intronic
1086322409 11:85664617-85664639 CCTCCTCCTCCATCTCCTCGGGG + Exonic
1087032082 11:93715894-93715916 AGACCCCCTCCTTCTGCTTGCGG - Intronic
1089192332 11:116662046-116662068 TCTCCACTTCCTTTTCCTTGGGG - Intergenic
1089286140 11:117409356-117409378 TCTCCCCTTCCTTCTCTCTGGGG + Intronic
1089349585 11:117814802-117814824 CGTCCCCCTCCTGCCCCCTGGGG + Intronic
1089634226 11:119802050-119802072 CCTCCTCCTCCTCCTCCTCCAGG - Intergenic
1089646065 11:119879921-119879943 CCTCCCATTCCTGCTCCCTGAGG - Intergenic
1089850107 11:121488289-121488311 CCTCTCCCTCCTTCTCTCTTGGG + Intronic
1089999805 11:122946939-122946961 CCTGCCCCTGCTACTCCCTGGGG + Intronic
1090213065 11:124936407-124936429 CCTAACACTCCTTCTCCCTGAGG + Exonic
1090612807 11:128486777-128486799 CCTTCCTCTCCTTTTCCTAGGGG - Intronic
1090659113 11:128869355-128869377 CCTCTCCCTCAGTCTCCTAGTGG - Intergenic
1090707806 11:129355197-129355219 CGTGCCCCTTCTTCTCCTTCTGG + Intergenic
1090938389 11:131365668-131365690 CCTCCTCCTCCTCCTCATGGTGG + Intergenic
1090951266 11:131475486-131475508 CCTCCTCCTCCTCCTCCTCAGGG - Intronic
1091000771 11:131909543-131909565 CCTGACCCACATTCTCCTTGGGG - Intronic
1091224789 11:133950876-133950898 CCTCCTCCTCCTCCTCCTCTGGG + Intronic
1091283175 11:134393872-134393894 CCTGTCCCTCCCTCTCTTTGGGG - Intronic
1091393915 12:142130-142152 CTCTCCCCTCTTTCTCCTTGGGG + Intronic
1092100985 12:5883610-5883632 CCACACCCTGCTTCTCCATGGGG - Intronic
1092112503 12:5973706-5973728 CCTCCCTCTTCTTCTTCCTGAGG + Intronic
1092127478 12:6085090-6085112 CCCTCCTCACCTTCTCCTTGGGG + Intronic
1092229677 12:6769605-6769627 CCTTCTCCTTCTTCTCCTTCAGG - Exonic
1092432408 12:8420103-8420125 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1092446728 12:8564769-8564791 CCTCCTCCTCCACCTCCTCGGGG - Intergenic
1093175662 12:15911176-15911198 CCTCCCCCGTCTTCTCCACGAGG - Exonic
1093464961 12:19439804-19439826 CCTCTTCCTCCTCCTCCTCGGGG - Exonic
1094454007 12:30611966-30611988 CCTCCTCCTCCTCCTCATCGTGG - Intergenic
1095737125 12:45569694-45569716 TCTTCCCCTCAATCTCCTTGGGG - Intergenic
1095830285 12:46578478-46578500 CTCACCCCTCCTTCTCCTTTTGG + Intergenic
1095964465 12:47857623-47857645 CCTCCTCCTCCTTCCGCTTCAGG + Exonic
1096596170 12:52696953-52696975 CCTCCCTCTTCTTCCCCATGTGG - Intronic
1097266944 12:57751578-57751600 CCTCCACCTCCTCCTCCATTGGG + Exonic
1098288463 12:68933059-68933081 CCTCCCTCTCCTCCTCCTCCTGG + Intronic
1098333292 12:69375887-69375909 CCTCCCCCTCCCTCTCTGCGCGG - Intronic
1098511547 12:71320360-71320382 ACTCACCCTCCTTGGCCTTGTGG + Intronic
1100167114 12:91928639-91928661 CCTCCCCCTTCATCAGCTTGGGG - Intergenic
1100550767 12:95644472-95644494 CCTGCTCCTCCTCCTCCTTCTGG + Intergenic
1100606736 12:96158115-96158137 CCTCCCCCTCCCTCTCCCCACGG + Intergenic
1100853728 12:98739922-98739944 CTACCACCTCCTTCTCCTTATGG + Intronic
1101029273 12:100644081-100644103 CCTGCACATCTTTCTCCTTGTGG + Intergenic
1101652118 12:106686856-106686878 TCTCTCCCTCCCTCCCCTTGTGG + Intronic
1102459476 12:113091397-113091419 CCTCCCCATCCGTCTACTTGGGG - Intronic
1102820973 12:115909073-115909095 CCTCCCCTGCCCTCTCCCTGCGG + Intergenic
1103485925 12:121282557-121282579 TCTCCGCCTCCATCTCCGTGTGG - Intronic
1103627947 12:122234915-122234937 CCCCCCTCTCCTTGTCCTTCAGG + Intronic
1103915159 12:124372341-124372363 CCTCCTCCTTCTCCTCCTTGGGG + Exonic
1104713044 12:130998184-130998206 CCTCCCCCTCCCTCTCCCCACGG - Intronic
1104950207 12:132436605-132436627 TCTCTCTCTCCTTCTCCTTCGGG - Intergenic
1104950213 12:132436635-132436657 TCTCTCTCTCCTTCTCCTTCAGG - Intergenic
1104950218 12:132436665-132436687 TCTCTCTCTCCTTCTCCTTCGGG - Intergenic
1104950230 12:132436719-132436741 TCTCTCTCTCCTTCTCCTTCGGG - Intergenic
1105249116 13:18680608-18680630 CCTCCTCCTCCTCCTCCTCGGGG - Intergenic
1106001414 13:25726932-25726954 ACTGCACCTCCTTCTCCTTGGGG - Intronic
1106132766 13:26953246-26953268 CCTCCCTTCCCTTCTCCTTAAGG - Intergenic
1107544189 13:41421669-41421691 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1107744818 13:43493154-43493176 CCTCCCACTCCCTCTCCTGTTGG + Intronic
1108092239 13:46860877-46860899 CCTCCCTCTCATTTTCCCTGTGG - Intronic
1108430972 13:50353304-50353326 CCTCCCACTCCTTTTTCCTGTGG - Intronic
1109301475 13:60593942-60593964 CTTCCGCCTCCTTCCCTTTGTGG - Intergenic
1109802977 13:67401716-67401738 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1110129319 13:71987539-71987561 CCTCCCTCTCTTCCTCCTTTTGG - Intergenic
1110376676 13:74802386-74802408 AGTCCCCTTCCTTCTACTTGAGG + Intergenic
1110805102 13:79745229-79745251 CCTCCCCATCCTATTCCATGTGG + Intergenic
1110863300 13:80367460-80367482 CTTGCCCCTCATTCTCCCTGAGG - Intergenic
1110959227 13:81599634-81599656 CCACCCCCTACTTCTGCTTGTGG - Intergenic
1111195446 13:84870182-84870204 CCTCATCCTCCTTCTCAGTGTGG - Intergenic
1112053866 13:95671650-95671672 CCACCCCCACCTTCCACTTGAGG - Intergenic
1112353502 13:98655700-98655722 CCTCCTCCTACTTCTCCCCGTGG - Intergenic
1112589627 13:100751319-100751341 CGCCCCCCTCCTGCTCCATGGGG + Intergenic
1113710605 13:112461903-112461925 CCACCCCCTCCCCCTCCCTGTGG - Intergenic
1113759535 13:112837823-112837845 CCTCCCCCTACAGCTCCTTCGGG - Intronic
1113792619 13:113037261-113037283 CCTCCACCTTCTACTCCTAGGGG - Intronic
1114248386 14:20935358-20935380 CCTCCTCCTCTTCCTCCTTTTGG - Intergenic
1115274304 14:31590347-31590369 CCTCCCATCCCATCTCCTTGAGG + Intronic
1115299959 14:31874076-31874098 TCTCCCCTTCCTTCCCCTTCTGG - Intergenic
1115484571 14:33898149-33898171 CCTCCTCCTCCCTCTCCTCCTGG - Intergenic
1115659136 14:35474605-35474627 CCTCCTCCTCCTTCTTCTTTTGG + Intergenic
1116588489 14:46740532-46740554 CCTCCCTCTCTCTCTCCTTTTGG - Intergenic
1117368253 14:55052017-55052039 CCTCCGACACCTTCTCCCTGGGG - Intronic
1117958622 14:61142050-61142072 TCTCCCCCTCTTTCTCCTGGAGG - Intergenic
1118718893 14:68579948-68579970 CCTCCCACACCTTCTCCTTCTGG - Intronic
1118723493 14:68610143-68610165 CCTCCCCAAACCTCTCCTTGAGG + Intronic
1118797063 14:69153158-69153180 CCTCCCTCTCCTTCCCCCCGAGG + Intergenic
1119484293 14:74978021-74978043 CTTCCTCCTCCTTCTCCTCCAGG + Intergenic
1119680246 14:76586642-76586664 TGTCCCCATCCTTGTCCTTGTGG + Intergenic
1120082700 14:80233803-80233825 CCTGCCCCTCCTTCTGATTAAGG + Intronic
1121310464 14:92932803-92932825 CCTCCTCTTTCTTCTCCTCGGGG - Exonic
1121777020 14:96597959-96597981 CCTCTGCCTCCTTCTCTTTCTGG + Intergenic
1122533424 14:102445216-102445238 CCTCCCCCTCCTTCCATATGGGG - Intronic
1122848738 14:104515218-104515240 CCTTCTCCTCCTTCTCAATGAGG - Intronic
1122862085 14:104587292-104587314 CCTCGGCCTCCTTTTCCCTGGGG - Intronic
1122899331 14:104775738-104775760 CCTCCTCCTCCTGCTTCTTGAGG + Exonic
1123222838 14:106872765-106872787 CCGCCCCCTCCGCCTCCCTGCGG + Intergenic
1123497548 15:20843364-20843386 CCTCCTCATCTTTCTCCTTTTGG - Intronic
1123554782 15:21417006-21417028 CCTCCTCATCTTTCTCCTTTTGG - Intronic
1123591028 15:21854320-21854342 CCTCCTCATCTTTCTCCTTTTGG - Intergenic
1124120265 15:26882922-26882944 CCTCCTCCTTCTGCTCCCTGGGG - Intronic
1124581645 15:30961031-30961053 CCTCCTCCTCCATCTCCTGAGGG + Exonic
1125334029 15:38610071-38610093 CCTCACCCTCCCTTCCCTTGAGG + Intergenic
1125543582 15:40486843-40486865 CCACCCCCTCCGTCTACCTGGGG - Intergenic
1125543893 15:40488576-40488598 CCACCCCCTCCGTCTACCTGGGG - Intergenic
1125657651 15:41371185-41371207 CCTCCTCCTCCTCCTCCTCCAGG - Intronic
1125896014 15:43302248-43302270 CATCTCCCTCCTTCTCCTGTCGG + Exonic
1126497120 15:49303831-49303853 TCTTCCCTTCCTTCCCCTTGAGG - Intronic
1126794319 15:52247537-52247559 CCAACTCCTCCTTCTCCTTTTGG - Exonic
1126837356 15:52679822-52679844 CCTCCTCCTCCTCCTCCTCCCGG + Intronic
1127264729 15:57352291-57352313 ACTCCCCTTCCTTCTCTTTCTGG - Intergenic
1128087075 15:64893970-64893992 CCTCCCCACCCTTCCCCTTCAGG - Intronic
1128119290 15:65133705-65133727 CCGCCGCCTCCTGCTCCTTTCGG - Exonic
1128648423 15:69393609-69393631 CCTCTCCCTCCTGCTCCATCCGG + Intronic
1128807816 15:70545747-70545769 CCTCCCACTCCTTCTCATAGGGG - Intergenic
1129362235 15:75031103-75031125 CCTGCCCCTCCTTCACTGTGTGG - Intronic
1129387493 15:75203728-75203750 CCTCCCCCACATGCTTCTTGGGG - Intronic
1130149401 15:81299824-81299846 CCTCCTCCTCCTCCTCCATCAGG + Exonic
1130787090 15:87111321-87111343 CTTCCTCCTCCTCCTCCTTCTGG - Intergenic
1131044049 15:89297761-89297783 CCTCCCCCTCCCTCTCCCCACGG - Intronic
1131121809 15:89827696-89827718 CCTCCCCCTCTGTCTCCTTGTGG - Intergenic
1131188420 15:90294330-90294352 CCTCCTCCTCCATCTCCTGTGGG - Intronic
1131308191 15:91264388-91264410 CCTCTCCCTCGTGCTCCTTAGGG - Intronic
1131899549 15:97072589-97072611 ACTCCCACTCCATCTCCTTGTGG + Intergenic
1132028040 15:98419558-98419580 CCTCCTCCTTCTCCTCCTTCAGG - Intergenic
1202963127 15_KI270727v1_random:144200-144222 CCTCCTCATCTTTCTCCTTTTGG - Intergenic
1132524141 16:406008-406030 TCTCCACCCCCTTCTCCCTGTGG - Intronic
1132680737 16:1140704-1140726 CCGGCGCCTCCTTCTCCTGGCGG + Intergenic
1133255620 16:4514096-4514118 CCTCCCCCTCCTTATCCTGGGGG - Exonic
1133274024 16:4625809-4625831 TCTCACCCTCCATCTCCTCGTGG + Intronic
1133410274 16:5562488-5562510 CCTCCCCCTTCTTCTCCTCCTGG - Intergenic
1133444614 16:5849377-5849399 CCTCCCTTTCCTACACCTTGAGG - Intergenic
1134241116 16:12507779-12507801 CCTCCCTCCCCTTATCCATGTGG + Intronic
1135232084 16:20718089-20718111 TCTCCTTTTCCTTCTCCTTGAGG - Intronic
1135354820 16:21760301-21760323 CCCACCCCTCCTCCTCTTTGGGG + Intronic
1135402818 16:22178063-22178085 CCTCTCTCTCCCTCTCCCTGTGG + Intronic
1135453304 16:22576443-22576465 CCCACCCCTCCTCCTCTTTGGGG + Intergenic
1135462852 16:22660043-22660065 ACTCCTCCTCCTACTCCTTCAGG - Intergenic
1135495578 16:22948504-22948526 CCTCCCCATCCTGCGCCATGGGG - Intergenic
1135892123 16:26366661-26366683 CCTCCCTCTCCCTCTGCTTTGGG - Intergenic
1136083890 16:27870850-27870872 CCTCTGCCACCATCTCCTTGTGG + Intronic
1136136027 16:28257471-28257493 CCTCCTCCTCCTCCTCCTGCAGG + Intergenic
1136173096 16:28499878-28499900 CCTCCTCCTCCTCCTCCGGGAGG + Exonic
1136293484 16:29289483-29289505 CCCCTCCCTCTGTCTCCTTGGGG - Intergenic
1136585088 16:31179619-31179641 CCTCCCTCTCCTGCGCCCTGAGG - Intergenic
1137354663 16:47749052-47749074 CTTCTCCCTCCTTTTTCTTGGGG - Intergenic
1137615883 16:49846704-49846726 CCTCCCTCTCCCTCTCCCTGGGG + Intronic
1137687791 16:50398845-50398867 CTTCTCTCTCCTTCTCCTTCGGG + Intergenic
1138094717 16:54202729-54202751 CCTCCCACTCCTTTTCCCTTTGG + Intergenic
1138378921 16:56586967-56586989 CCTACCCCTCATCCTCCATGTGG - Intergenic
1138431354 16:56971190-56971212 CCACTCCCACCTTCTCCATGTGG + Intronic
1138542670 16:57697958-57697980 CCTCCTCCACCTTCTCCCTCAGG - Exonic
1138560799 16:57799981-57800003 CAGCCACTTCCTTCTCCTTGGGG + Intronic
1139103878 16:63802363-63802385 ACTCCCCTTCCTTCCACTTGAGG - Intergenic
1139431929 16:66915355-66915377 CATCCCCTTCCTCTTCCTTGAGG - Exonic
1139538287 16:67593351-67593373 CCTCCCCCTCCTAATCCCTAAGG + Intronic
1139546486 16:67652309-67652331 TCTCCTCTTCCTTCTCCTCGGGG - Exonic
1139658846 16:68406391-68406413 CCTGGCCCTCCTCTTCCTTGGGG + Intronic
1139824666 16:69747591-69747613 CCACCCACTCCTTCTACTTGTGG + Intronic
1139857170 16:69990208-69990230 CCTCCTCCTCCTCCTCCTCCAGG - Intergenic
1140024270 16:71270236-71270258 CCTCCTCCTCCTTCTCCATCTGG - Intergenic
1140084025 16:71777765-71777787 CCTCCTCCACCTTCTCCTTCAGG + Intronic
1140107295 16:71972415-71972437 CATCCTCCTCCTCCTCCTTCTGG + Intronic
1140223319 16:73058939-73058961 CCTCCTCCTCCTCCTCCTCCCGG - Intronic
1140287778 16:73620979-73621001 CCTGCCCCTTGGTCTCCTTGGGG + Intergenic
1140375040 16:74438478-74438500 TCTTCCTCTCCTTCCCCTTGGGG + Intergenic
1140749579 16:78011035-78011057 ACTCCCCCTGCTTATCCATGTGG + Intergenic
1140750350 16:78017923-78017945 CCTGCCCCACCTTGTCTTTGGGG - Intergenic
1141149866 16:81556583-81556605 GCTCCCCTTCCTTCTACCTGTGG - Intronic
1141831129 16:86510492-86510514 CCTCCTCCTCCTCCTCCTCCCGG + Intergenic
1142099364 16:88263489-88263511 CCCCTCCCTCTGTCTCCTTGGGG - Intergenic
1142767669 17:2074840-2074862 CCTGCCCCTCCCTCTCCATCAGG - Intronic
1142863412 17:2776821-2776843 CCTCCTCCTCCTCCTCCTCCGGG - Intergenic
1142915304 17:3131653-3131675 CCTCACCCTCCTTCATCGTGGGG + Intergenic
1143150153 17:4802551-4802573 CCACCTCCTGCTTCTCCATGGGG - Intergenic
1143374523 17:6459369-6459391 CCTCCCCCTCACTCTCCTCCTGG + Intronic
1143444182 17:6997385-6997407 CCACCCCCTCCTGTTCCATGTGG - Intronic
1143471202 17:7177234-7177256 CCTCAGCCTCCTGCTGCTTGTGG - Exonic
1143474024 17:7192801-7192823 CCTCCACCTCCTTCTCCTCTTGG - Intronic
1143592659 17:7894910-7894932 GGACCCCCTCCTTCTCCTAGGGG - Exonic
1144621667 17:16822313-16822335 CCTCCTCCTGCTTCTCCTCTGGG - Intergenic
1144671778 17:17136858-17136880 CCTTCCCCTCCTTCTGCCAGGGG - Intronic
1144866207 17:18337561-18337583 CCTCCCCCTCCCTCTCCCCACGG + Intronic
1144884752 17:18450401-18450423 CCTCCTCCTGCTTCTCCTCTGGG + Intergenic
1145147473 17:20493976-20493998 CCTCCTCCTGCTTCTCCTCTGGG - Intergenic
1145214443 17:21041979-21042001 CCTCCACCTCCAGCTCCTCGCGG + Intronic
1145888486 17:28398618-28398640 CCTCCCCCTACTTCTCCCCAAGG + Exonic
1145921151 17:28611142-28611164 CCTCTCACTCCTGCTCCATGAGG - Exonic
1146049042 17:29533826-29533848 CCTCCCCCTCCCTCTCCCCACGG - Intronic
1146656300 17:34637155-34637177 CCTCCTTCTCCTTCTCCTCCAGG + Exonic
1146923050 17:36726635-36726657 ACACCCTGTCCTTCTCCTTGTGG + Intergenic
1147211505 17:38874915-38874937 CCCCACCCTCCTTCTCCAAGGGG + Intronic
1147384083 17:40071600-40071622 CCGCCCCCTCGGCCTCCTTGGGG + Intronic
1147528175 17:41247345-41247367 CCTCTTCTTCCTTCTCCTAGAGG - Intronic
1147742202 17:42675894-42675916 CTCCCACCTCCCTCTCCTTGGGG + Intronic
1147924050 17:43935854-43935876 CCTCTGCCTCCTTCTCCTGCAGG - Intergenic
1147933745 17:43999302-43999324 CCTCCCTCTCGTTCTCCCTTAGG - Intronic
1148157778 17:45433163-45433185 CCACCCCCTCTTGATCCTTGTGG + Intronic
1148383044 17:47213869-47213891 CCTCCTCCTCCTCCTCCTCCAGG - Intronic
1148483398 17:47975256-47975278 CCTGGCACTCCTCCTCCTTGCGG - Exonic
1148662764 17:49348548-49348570 CCTCTCCATTCCTCTCCTTGCGG - Intronic
1148698774 17:49576138-49576160 CTTCCCCTTCCTGCTCCTTCAGG - Exonic
1148732818 17:49847984-49848006 CCTCGCCCTGCTTCTCCTGATGG - Exonic
1149038387 17:52158928-52158950 CCTCCTCCTCCTCCTCCTCATGG - Intronic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1150283571 17:63943411-63943433 CATCCTCCTCCTTCCACTTGTGG + Intronic
1150433445 17:65137193-65137215 CCTCCTCCTCCTTCTCCTCCCGG + Intergenic
1150627482 17:66850753-66850775 CATCCCCCTCCCTTTCCTAGGGG - Intronic
1150944456 17:69729893-69729915 CCTCTGCCTCCTTCTGCTTTTGG + Intergenic
1151369051 17:73635944-73635966 CCTCCTCCTCCTGCTCCTCCTGG - Intronic
1151569155 17:74917482-74917504 GCTCCCCCTCCTTCACCTAGTGG - Exonic
1151727839 17:75894850-75894872 CGGCCCCCTCCTGCTCCTGGCGG + Intronic
1151827025 17:76529362-76529384 CCGCCCACTTCTGCTCCTTGTGG - Intronic
1151975972 17:77483677-77483699 GCTGCCTCTCCCTCTCCTTGGGG - Intronic
1151989750 17:77566716-77566738 GCACCCCAGCCTTCTCCTTGTGG + Intergenic
1152228284 17:79102624-79102646 CCTCTCCCTGCTCCTCCTTGGGG + Intronic
1152231894 17:79117975-79117997 CCACCCCCTCCTTCTGTTTATGG + Intronic
1152315408 17:79577753-79577775 TCTCCCTCCCCTTCTCCTTTGGG - Intergenic
1152322374 17:79614917-79614939 CCTCCTCCTCCTTCTCTCTGGGG - Intergenic
1152438277 17:80289138-80289160 CCTCCCCCAACTCCTCCTGGGGG - Intronic
1152660819 17:81541129-81541151 CCTGCCCCTCATCCTACTTGAGG - Intronic
1153202411 18:2659444-2659466 CTTCCCTCTCCTTTTCCATGAGG - Intronic
1153950567 18:10054539-10054561 CCACCCCCTCACACTCCTTGTGG + Intergenic
1154290120 18:13099165-13099187 CCTCCCCCTCCCTCTCCCCATGG - Intronic
1154386519 18:13897602-13897624 ACACCCCTTCCTTCTGCTTGAGG + Intronic
1154394611 18:13975670-13975692 CCTCCTCCTCCTCCTCCTTCTGG + Intergenic
1154439769 18:14378622-14378644 CGTCCTCCTCCTCCTCCTCGGGG + Intergenic
1154455567 18:14519783-14519805 CCTCCTCATCTTTCTCCTTTTGG - Intronic
1155654206 18:28176644-28176666 CCTCACCCTCCTGCTGCCTGGGG + Intronic
1156352132 18:36310766-36310788 CCCCACCCTCCTTCTCCACGAGG - Intronic
1156632881 18:38991523-38991545 CCTCCCTCTCTTCCTCCTTTTGG - Intergenic
1157605631 18:48924302-48924324 CCTCCTCCTCCTCCTCCTGTTGG - Intronic
1158292215 18:55954955-55954977 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1158558376 18:58493496-58493518 CCGTCCCCTCCATCTGCTTGTGG + Intronic
1159548206 18:69867393-69867415 TCTCTCTCTCCTTCTCCTTCTGG + Exonic
1159673368 18:71250998-71251020 CCTCCCCCACCTTCTCCCCATGG - Intergenic
1159857347 18:73604945-73604967 CCACCACCTCCTTCTACTAGAGG + Intergenic
1160034228 18:75286286-75286308 CCTTCCCCTCCATCTCCATCAGG - Exonic
1160095316 18:75866383-75866405 CCTCCGCCTCCGTCACCTTGCGG + Intergenic
1160406142 18:78647452-78647474 CCTCCGCCTCCTGCTCCTGCGGG - Intergenic
1160486677 18:79299608-79299630 CCTCACCCTCCTTGTGTTTGGGG + Intronic
1160619078 18:80157943-80157965 CCTCCCGCTGCTTCTCCTTGTGG - Exonic
1160690912 19:460460-460482 CCTCCCCCACCCTCTCCTCCGGG - Intronic
1161316364 19:3619376-3619398 CCTCCTCCTCCTCCTCCTCCAGG - Intronic
1161361084 19:3850147-3850169 CATGCCCCTCCTTCTCCCAGAGG - Intronic
1161439004 19:4279972-4279994 CCACCTCCTCCTCCTCCTTGGGG + Exonic
1161588897 19:5119788-5119810 GCTCCTCCTCCTCCTCCTCGGGG - Exonic
1161679048 19:5669873-5669895 CCTGCCCTTCCTTCTCCTGCTGG - Intergenic
1161950454 19:7464896-7464918 CCTCCCCAGCCTTCCTCTTGGGG - Intronic
1162084190 19:8238551-8238573 CCTCCACCTCCTTACCCTTCTGG - Intronic
1162254943 19:9482648-9482670 CCTCCCCCTCCCTCTCCCCACGG + Intronic
1162284231 19:9726329-9726351 CCTGCACATCTTTCTCCTTGTGG + Intergenic
1162341175 19:10092239-10092261 CTTCCTCCTCCTCCTCCTTCAGG - Exonic
1162346248 19:10119657-10119679 CCTCCCCCTCCTCCTCCACCTGG + Exonic
1162439027 19:10681265-10681287 CCTCCCCGTCCTCCTCCATTGGG - Exonic
1162548018 19:11342734-11342756 CCTCCCCCTGCTTCTCATGGGGG + Intronic
1162805492 19:13136041-13136063 CCTCCTCGTCCTCCTCATTGTGG - Exonic
1162818138 19:13208241-13208263 CCTCCCCTCCCTCCTCCCTGTGG - Intronic
1163086051 19:14980100-14980122 CCGCTGCCCCCTTCTCCTTGCGG + Intronic
1163223496 19:15938327-15938349 CCTCCCCCTGCTGCAACTTGTGG - Intergenic
1163263158 19:16203524-16203546 CCTCCTCCTCCTTCTCCATCAGG - Exonic
1163554623 19:17984982-17985004 CCTCCACCTCCTGCTGCTTCTGG + Intronic
1163574261 19:18101371-18101393 CCTCCTCCTCCTCCTCCTCCTGG + Intronic
1163714539 19:18866203-18866225 CCCTCCCATCCTTCTCCTTGAGG - Intronic
1164188330 19:22892822-22892844 CCTCCTCCTCCTCCTCCTGTAGG + Intergenic
1164451612 19:28370895-28370917 CCTCCCGCTCCTGGTCCCTGAGG - Intergenic
1164452674 19:28380612-28380634 CCTCCCCCACCTTCTTCTTCTGG + Intergenic
1164504590 19:28848972-28848994 CCTCCCCCTCCATCACATTTTGG + Intergenic
1164576522 19:29408407-29408429 CTTCCTCCTGCTTCTGCTTGCGG - Intergenic
1165269470 19:34692739-34692761 CCTCCCCTTCATTCTCTGTGTGG + Intergenic
1165349285 19:35267638-35267660 CCTCTTCCTCCTCCTCCTTGTGG - Exonic
1165435060 19:35790893-35790915 CCACCCCCACCTCCTCCCTGGGG + Intergenic
1165470806 19:36003447-36003469 CCTCCTCTTCCTCCTCCTGGTGG - Exonic
1165772862 19:38388742-38388764 CCTCCTCCTCCTTTTCGTTCCGG - Intronic
1165798989 19:38536228-38536250 CCACCCCCTCCATCCCCCTGGGG + Intronic
1165850936 19:38849983-38850005 CCTCCCCCCGCCTCTCATTGGGG + Exonic
1165861004 19:38909310-38909332 GCTCCACCTCCTTTTCCTGGTGG + Exonic
1165861286 19:38910862-38910884 CCTCCTCGTCCTCCTCCTGGTGG + Exonic
1166039271 19:40192028-40192050 CCCCCTCCTCCTCCTCCATGGGG - Exonic
1166072242 19:40394277-40394299 CCTCCTCCTCCTCCTCCTCGGGG + Exonic
1166503440 19:43356966-43356988 CCTCCCCCTCCTAGTCCTGGAGG - Intronic
1166507014 19:43377795-43377817 CCTCCCCCTCCTAGTCCTGGAGG + Intergenic
1166560793 19:43731325-43731347 CCTCCCACTGCTTGTCCCTGTGG + Exonic
1166794360 19:45417419-45417441 CCTCCTCCTCATCCTCCTTTGGG - Intronic
1167622032 19:50566068-50566090 CCTCCTCCTCCTCCTCCCTGGGG - Intronic
1168152514 19:54456521-54456543 CCTCCTCCTCCTTCTCCCATGGG - Intronic
1168217803 19:54939354-54939376 CCTCCCCCTCCTCCTTCTCCAGG + Exonic
1168351991 19:55681126-55681148 GCTCACCCTCCTTCTCCACGGGG - Intronic
1168489666 19:56797654-56797676 CCTCCTCTTCCTCCTCCCTGAGG + Intronic
1168694322 19:58396200-58396222 CCTCCTCCTCCTCCTCCTCCTGG - Exonic
1168725878 19:58581738-58581760 CCTCGCCCTGCTCCTGCTTGCGG - Intergenic
925632452 2:5908792-5908814 CCTCCACCCTCTTCTCCCTGAGG - Intergenic
925718114 2:6803357-6803379 CCTCCCCCTCCTCCTCATCATGG - Intergenic
927168783 2:20351031-20351053 CCTCCCCCGCCCTCACCTTGCGG + Intronic
927216203 2:20669070-20669092 CCTCTCCCTCCTCCCTCTTGGGG + Intronic
927636378 2:24820111-24820133 GCTCCCCCTCCCTCTCCAGGTGG - Exonic
927652245 2:24919893-24919915 CCGCCTCCTCCTTCCCCCTGCGG - Intergenic
927880954 2:26689860-26689882 CCAGTCGCTCCTTCTCCTTGAGG - Intergenic
928086601 2:28350053-28350075 CCTCCTCCTCTTCCTCCATGAGG + Intergenic
928284750 2:29980092-29980114 CCTGCCCCTTATTCTCCTTGTGG - Intergenic
928904555 2:36356039-36356061 CCTCCTCCTCCTCCTCCTCCCGG - Exonic
930015227 2:46965439-46965461 CCTGCTCCTCCTTCTCCATCTGG - Intronic
930553587 2:52867605-52867627 CTTCCCCCTCCTTCTCTTCCAGG + Intergenic
931218890 2:60271267-60271289 TCTCCCTTTCCTTCTCATTGTGG - Intergenic
931473785 2:62567585-62567607 CCTCTCCCTCCTGCTCCCTTAGG - Intergenic
931794988 2:65700474-65700496 CCCACCCCTTCCTCTCCTTGAGG + Intergenic
932336698 2:70935801-70935823 CCTCCCTCTCCTCCTCCTCTAGG - Intergenic
932349916 2:71023394-71023416 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
933418992 2:82023711-82023733 CCTCCTCCTCCTCCTCAGTGTGG - Intergenic
933637230 2:84721417-84721439 CCTTCCCCTCCCTTTCCTGGTGG + Intronic
933895592 2:86807782-86807804 ACTCCTCCTCCGTCTCCTTTAGG - Exonic
934666405 2:96174332-96174354 CATCACCCTCCTGCTCCTGGAGG - Intergenic
936065047 2:109324824-109324846 ACTCTCCGTCCCTCTCCTTGAGG + Intronic
937099851 2:119260215-119260237 CCTCCCACCCCTCCTCATTGTGG - Intronic
938229962 2:129649811-129649833 CCTCCACCTCCTTCTCTAGGAGG + Intergenic
938284405 2:130097008-130097030 CCTCCTCATCTTTCTCCTTTTGG - Intronic
938335044 2:130485572-130485594 CCTCCTCATCTTTCTCCTTTTGG - Intronic
938354781 2:130635096-130635118 CCTCCTCATCTTTCTCCTTTTGG + Intronic
938413178 2:131082292-131082314 GGTCCCACTCCTTCTCATTGTGG - Intronic
938431202 2:131241883-131241905 CCTCCTCATCTTTCTCCTTTTGG + Intronic
938619202 2:133031699-133031721 ACACCCCTTCCTTCTACTTGAGG + Intronic
938736554 2:134191514-134191536 CCTCCTCCTCCTCCTCCTTGCGG + Intronic
938783069 2:134602843-134602865 CCCGTCCCTCCTTCTCCCTGGGG + Intronic
939988561 2:148855797-148855819 CCTCCCCCTACTTTTTCTTCTGG - Intergenic
940271897 2:151900029-151900051 CCTCCCTCACCTTCTCCCTGAGG - Intronic
940869494 2:158848171-158848193 CCTGCACCTCTCTCTCCTTGGGG - Intronic
940872168 2:158869169-158869191 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
942240888 2:173964019-173964041 CCTCCTCCTCCTCCTCCTCCTGG + Intronic
942369254 2:175264485-175264507 TTTCCCCCTCTTTCTCTTTGGGG + Intergenic
943695102 2:190918850-190918872 CATCTCTCTCCCTCTCCTTGGGG - Intronic
945360529 2:208890922-208890944 GCTCACCCTCCTTTTCCTGGAGG + Intergenic
946154311 2:217797200-217797222 CATCCACTTCCTCCTCCTTGAGG + Intergenic
946182963 2:217959994-217960016 CCTCCTCCTCCTCCTCCTGCCGG - Intronic
946432153 2:219631653-219631675 ACTGCCCCTCCTTCTCCATCTGG - Intronic
946604625 2:221389766-221389788 TCTCTCCCTCTTTCTCCTTTAGG - Intergenic
946974859 2:225137037-225137059 ACACACCCTCCGTCTCCTTGAGG - Intergenic
947172566 2:227325624-227325646 CCTCTCCCTCGCTCTCCTCGGGG - Intronic
947594973 2:231405316-231405338 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
947612766 2:231533878-231533900 CCTGCCTCTCCTGCTCCTAGAGG + Intergenic
948098417 2:235354759-235354781 CCTCCCTTTCTTTCCCCTTGAGG - Intergenic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
1168737281 20:152099-152121 CCACACTCTCCCTCTCCTTGAGG - Intergenic
1168892805 20:1305775-1305797 CCTCCTCCTCCTCTTCCATGGGG - Exonic
1169030281 20:2401332-2401354 CCTCCCCATCCTCCTCCTGGAGG + Intronic
1169449706 20:5701337-5701359 CCTCCCCCTCCCTCTCCCTCCGG + Intergenic
1169699847 20:8433726-8433748 CCTCCTCCTCCTCCTCCTCATGG + Intronic
1170112018 20:12815364-12815386 CCTCCCCCTCCTACTCCCGATGG - Intergenic
1170854563 20:20039261-20039283 CATCCCCCTCGTTCTCCGGGTGG + Intronic
1171130953 20:22652585-22652607 CCTCCCCCTCCTCTTACATGTGG + Intergenic
1171334127 20:24368159-24368181 CCTTACCCTCCCTCTCCTGGGGG - Intergenic
1172034836 20:32003255-32003277 CCTCCCCCTCCCCCTCCTGGGGG - Exonic
1172414940 20:34757612-34757634 CCTCCCCCTCCATATCCCTTTGG - Exonic
1172670908 20:36633850-36633872 CCACCCACTGCTTCTCCCTGTGG + Intronic
1172789558 20:37493393-37493415 CCCACTGCTCCTTCTCCTTGTGG - Intronic
1172893571 20:38283950-38283972 CACTCCCCTCATTCTCCTTGGGG - Intronic
1173258836 20:41415255-41415277 CCTCCCTCTCCGCCTCCTCGTGG + Exonic
1173572684 20:44087706-44087728 CCTGCCCCAACTTATCCTTGAGG + Intergenic
1173909206 20:46651532-46651554 CCTCTCCCTGCTCCTCCTGGAGG + Intronic
1173970295 20:47147378-47147400 CCTCCTCCTCCACCTCCTTCAGG - Intronic
1174083690 20:47989595-47989617 ACTCCCCATCCCTGTCCTTGTGG - Intergenic
1174749431 20:53097140-53097162 CATCCCCCTCCTTGTCCCAGGGG - Intronic
1174895251 20:54442174-54442196 CCTCCCCCTCCTCCTGGTTATGG + Intergenic
1174935272 20:54861021-54861043 CCTCCTCCTCCTTCTCTTCTTGG - Intergenic
1175166339 20:57047274-57047296 CCTCCCCCTCCTTCCCAATTCGG + Intergenic
1175291503 20:57878997-57879019 CCTCTTCCTCCTCTTCCTTGTGG - Intergenic
1175576078 20:60061711-60061733 CCCCACCCTCCCTTTCCTTGGGG + Intronic
1175859969 20:62144532-62144554 CCGCCCCCTCCGTATCCTCGCGG + Intronic
1176230997 20:64032834-64032856 CCTCCTCCTGCTGCTCCTGGGGG - Exonic
1176235104 20:64050286-64050308 CCTGCTCCCCCTTCTCTTTGTGG - Intronic
1176362061 21:6006179-6006201 CCCCCTCCTCCTCCTCCTTTTGG - Intergenic
1176426390 21:6551112-6551134 CCTCGCCCTGCTTCTCCTCGAGG - Intergenic
1176455975 21:6911151-6911173 CGTCCTCCTCCTCCTCCTCGGGG - Intergenic
1176818601 21:13633532-13633554 CCTCCTCATCTTTCTCCTTTTGG + Intronic
1176834149 21:13776199-13776221 CGTCCTCCTCCTCCTCCTCGGGG - Intergenic
1176918985 21:14663635-14663657 CTTCCCCTTCCTCCTCCTTCTGG - Intergenic
1178383277 21:32129348-32129370 CCCCCTCTTCCTGCTCCTTGGGG + Intergenic
1178640350 21:34340255-34340277 CCTCCTCCTCCTCCTCCTCCTGG - Intergenic
1178684740 21:34702223-34702245 GCTCCCCCACCTTTTCCTCGTGG + Intronic
1178691538 21:34754248-34754270 CCTCACCCTGCTTGTCCTTCTGG + Intergenic
1178867288 21:36339849-36339871 CCTACCCCTCCTTCTCCTGGAGG + Intronic
1178932254 21:36829814-36829836 CCTGCCCCTCCTTCCCTCTGCGG - Intronic
1178981395 21:37267835-37267857 CCTCCACCGCTTTCTCCCTGGGG + Intronic
1179377284 21:40861927-40861949 CTTCCGTCTCCCTCTCCTTGAGG - Intergenic
1179701881 21:43159429-43159451 CCTCGCCCTGCTTCTCCTCGAGG - Exonic
1179761457 21:43532366-43532388 CCCCCTCCTCCTCCTCCTTTTGG + Intronic
1179887412 21:44320135-44320157 CCTGCCTCACCTTCTCCTTGGGG - Exonic
1179928809 21:44552985-44553007 CCTCCCCCTCATACTCCATTAGG - Intronic
1180228853 21:46414380-46414402 CCTTCTCCTCCTTCTCCTCTGGG + Intronic
1180228860 21:46414419-46414441 CCTCCTCCTCCTCCTCCTCCTGG + Intronic
1180476402 22:15713434-15713456 CCTCCTCATCTTTCTCCTTTTGG + Intronic
1181440487 22:22933031-22933053 CCTCCCTGTCTTTCTCCATGTGG + Intergenic
1182451456 22:30424205-30424227 CCTCCGCCTCCCTCTCATTCTGG - Exonic
1182705125 22:32272174-32272196 CCTCCTCCTCCTCCTGCATGAGG - Intergenic
1183146332 22:35995889-35995911 CCTCCTCCTCCTGCTTCTTGAGG + Intronic
1183195226 22:36349080-36349102 CTTCGCCCACCTCCTCCTTGAGG + Exonic
1183252019 22:36737033-36737055 CCTCCTCCTGCACCTCCTTGGGG - Intergenic
1183362104 22:37388049-37388071 CCTCCCCCTACTGCTCCTGCTGG + Intronic
1183446683 22:37861225-37861247 ACTCACCCCTCTTCTCCTTGAGG + Intronic
1183628231 22:39017747-39017769 CCTCCTCCTCCTTCGCCAGGTGG + Exonic
1183630831 22:39031675-39031697 CCTCCTCCTCCTTCCCCAGGTGG + Exonic
1183634347 22:39052055-39052077 CCTCCTCCTCCTTCCCCAGGTGG + Exonic
1184265121 22:43342614-43342636 CCTCCTCCTCCTTCCCCGGGCGG + Intronic
1184292011 22:43502421-43502443 CCTCACCCTCCTCCTCCATAGGG - Intronic
1184305890 22:43601694-43601716 CCTGCCACCCCTTCCCCTTGAGG - Intronic
1184426789 22:44413730-44413752 CCTCCTCCTCCTCCTCCTGAGGG - Intergenic
1184492945 22:44820623-44820645 CCTCCCTCCCCTTGTGCTTGGGG + Intronic
1184566137 22:45293260-45293282 CCTGCCCTTCTTTCTACTTGTGG + Exonic
1184935998 22:47721396-47721418 CCTCCTCCTCCTCCTTCCTGTGG + Intergenic
1185070696 22:48654224-48654246 CCTCCTCCTCCTCCTCCTCTTGG - Intronic
1185173861 22:49308095-49308117 TCTCTTCCGCCTTCTCCTTGGGG - Intergenic
1185264740 22:49894995-49895017 CCTGCCCCTCCTCCTCCTCCTGG - Intergenic
949550056 3:5105116-5105138 CATCCCCCTCCCCCTCCTGGGGG + Intergenic
949884528 3:8682754-8682776 CCTGCACCTCTCTCTCCTTGGGG - Intronic
949944257 3:9177748-9177770 CCTCCCATTCTTACTCCTTGTGG + Intronic
950491179 3:13305932-13305954 CCTGCTCCTACTGCTCCTTGGGG + Intergenic
950532505 3:13560457-13560479 TGTCTCCCTCCTCCTCCTTGGGG + Intronic
950543240 3:13624720-13624742 CCTCCACCTGCCTGTCCTTGAGG + Intronic
952241207 3:31532903-31532925 CCTCCTCCTCCTCCTCCTCCGGG + Exonic
952371881 3:32730318-32730340 CCTCCCGCTCCTTCTCCTCTAGG - Intronic
953966355 3:47309975-47309997 CCTCCCCCTCCCTCTCCCCACGG - Intronic
954680732 3:52344613-52344635 CCTGCTCCTCCTCCTTCTTGGGG - Exonic
954687594 3:52379102-52379124 CTTCCCCCTCCTTCCACCTGGGG - Intronic
954993125 3:54858188-54858210 TCTGCACCTCCTTCCCCTTGTGG + Intronic
955146584 3:56326039-56326061 CCTCACTCTCCTTCTTCTAGCGG + Intronic
955423641 3:58764793-58764815 CCTCTTCCTCCTTCCTCTTGAGG + Intronic
955772936 3:62404746-62404768 CCTACCCCTCCTGCTCCCTGGGG - Intronic
956073372 3:65478625-65478647 CCTCCTCCTCATTCTCCGCGTGG + Exonic
957044420 3:75362925-75362947 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
957406257 3:79777368-79777390 CCTGCACATCTTTCTCCTTGTGG - Intergenic
958907087 3:99954043-99954065 CCACCACCTTCTCCTCCTTGAGG - Intronic
959775991 3:110163576-110163598 CCTCCCACTTCTTCTGCTTTGGG + Intergenic
960009352 3:112816586-112816608 CATCCTCCCCTTTCTCCTTGTGG - Intronic
960061741 3:113329996-113330018 CCTCCCCATCCTTGGCCTTCTGG - Intronic
961094750 3:124144673-124144695 CCTCCTCCTCTTCCTCCTTCTGG + Intronic
961115171 3:124323221-124323243 CCTCCCCATCCTTTTTCATGCGG + Intronic
961278004 3:125742701-125742723 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
961357396 3:126347783-126347805 CCTCCACTTCCTTCTGCTTTTGG - Intronic
961421835 3:126812265-126812287 CCTCCCTCCCCTTCTCTCTGTGG + Intronic
961665562 3:128491585-128491607 ACGGCCCCTCCTGCTCCTTGAGG + Intronic
961714460 3:128849114-128849136 CCTCCTCCTCCTCCTCGATGTGG + Intergenic
961876412 3:130026959-130026981 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
962157629 3:132965268-132965290 CATGCCCCTCCTTGTCTTTGAGG - Intergenic
962390243 3:134965749-134965771 CCGCCCCCACCTCCACCTTGAGG + Intronic
962422346 3:135239720-135239742 CCTCCCATTACTTCTCCTTCAGG + Intronic
962515124 3:136143029-136143051 CCTCTTCCCCCATCTCCTTGAGG - Intronic
962878708 3:139555894-139555916 CCTCCCTGCCCTTCTCCTTGGGG - Intergenic
963155546 3:142092158-142092180 CTTTACCCTCCTTCTCCTAGTGG + Intronic
963327357 3:143877154-143877176 CCTCCTCCTCCTCCATCTTGAGG + Intergenic
963902565 3:150746425-150746447 CCTCACCTGCCTTCTCCTTTAGG - Intronic
964445416 3:156752689-156752711 CCTCCTCTTCCTCCTCCTTCTGG - Intergenic
964522421 3:157583404-157583426 CCTGCACATCTTTCTCCTTGTGG + Intronic
964847828 3:161062805-161062827 CCTCCCCTTCCCTCTCATGGAGG + Intronic
965826035 3:172730529-172730551 CCTCCACCTGCTTCACCTGGTGG - Intergenic
966025961 3:175282470-175282492 CCTCTTCCTCTTTCTCCTTAAGG - Intronic
967109943 3:186284310-186284332 CCTCCCCCGCCCTCTCCTCTTGG + Intronic
967251111 3:187539835-187539857 CCTCCTCCCCTTTCTCCTTGGGG - Intergenic
967953259 3:194857200-194857222 CCTGCCCCCCGTTCTCCTTGTGG + Intergenic
968293291 3:197555246-197555268 CCTCCTCCTCCTCCTCCTCCGGG - Intronic
968907758 4:3462548-3462570 ACTCCCCCTCCTTGACCCTGTGG - Intergenic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
968988684 4:3894165-3894187 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969019663 4:4131408-4131430 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969024367 4:4161808-4161830 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969025272 4:4167754-4167776 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969056914 4:4407924-4407946 GCTAACCCTCCTTCTCTTTGGGG - Intronic
969110202 4:4839699-4839721 CCTGCCCCACCTTGTCCTTCTGG + Intergenic
969342848 4:6553192-6553214 ACTCCCCGTTCTTCTCCCTGCGG - Intronic
969553796 4:7892438-7892460 CCTCCCCCAGTGTCTCCTTGGGG - Intronic
969576677 4:8040128-8040150 CATCCCCTTCCTTCACCGTGAGG - Intronic
969699573 4:8760796-8760818 CCCCTCCCTGCTTCTCCCTGTGG + Intergenic
969793776 4:9510064-9510086 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
970333026 4:15003754-15003776 CCTCCCCCTCCGCCTCCTGGGGG - Exonic
971364876 4:25969625-25969647 CTTCCCCACTCTTCTCCTTGGGG - Intergenic
971494808 4:27252278-27252300 CCTCCTCCTCCTTGACCCTGAGG - Intergenic
971506281 4:27369787-27369809 CCTCCCTCTCTTTCTCCCTGGGG - Intergenic
971889327 4:32497012-32497034 CCTACCCCACCCTCTCCTGGTGG + Intergenic
972104204 4:35462037-35462059 ACACCCCTTCCTTCTGCTTGAGG - Intergenic
972163428 4:36253330-36253352 CCTCACCCTGTTTCTCCTTGGGG + Intergenic
972489879 4:39577168-39577190 CCTCCTCCTCCTCCTCCTGGTGG - Intronic
972541577 4:40043702-40043724 CCTCCTCCTCCTGCTCCTGCCGG + Intergenic
973689524 4:53410957-53410979 CCCCCCCCACCTTATTCTTGGGG - Intronic
974036461 4:56821974-56821996 TCTTCCCCTTCGTCTCCTTGGGG - Intergenic
974993897 4:69128977-69128999 CCTCCTCCTCCTCCTTCTTCAGG - Intronic
975023152 4:69515992-69516014 CCTTCCCCTGTTTCTCCTTCAGG + Intronic
975240710 4:72055468-72055490 CTCCCCTCTCCCTCTCCTTGAGG + Intronic
975848200 4:78547324-78547346 CCTCCCCCTCCCTCTCCCCACGG + Intergenic
976005572 4:80425489-80425511 TCACCCCTTCCTTTTCCTTGGGG + Intronic
977151995 4:93524041-93524063 CCTCACCCTCCTTCTGCTGATGG - Intronic
977603201 4:98956171-98956193 CCTCCACCTCCTTCTTCTTCTGG - Intergenic
977951453 4:102975487-102975509 CATTCCCCTCCTTTTCCTGGAGG - Intronic
978362687 4:107947859-107947881 CCTCTCCCTCCTTTTCATGGAGG + Intronic
978372950 4:108047313-108047335 CCTCTCCCTCCTTTTCCAGGTGG - Intergenic
980542970 4:134218549-134218571 CCTCACACTCTTTCTCCTTCTGG - Intergenic
980780124 4:137482850-137482872 CCTGCACATCTTTCTCCTTGTGG - Intergenic
981500798 4:145449474-145449496 ACACCCCCTCCATCTCTTTGGGG - Intergenic
981798745 4:148631032-148631054 CCACCATCTCCTTCTCCTTTGGG - Intergenic
982562709 4:156949803-156949825 CCTTCCCCTACGTCCCCTTGAGG + Intronic
983421791 4:167527360-167527382 AGTCCCCTTCCTTCTGCTTGAGG - Intergenic
983919823 4:173333857-173333879 CCTCCTCCTCCTCCTCCTCCCGG + Intronic
984068564 4:175082152-175082174 ACACCCCTTCCTTCTGCTTGAGG - Intergenic
984759104 4:183348560-183348582 CCTCACCCTCCTTCCCCTCATGG + Intergenic
984814169 4:183821758-183821780 CCTCCCCCTCCACATCCCTGCGG + Intergenic
985084151 4:186295942-186295964 CCTCTCCCTCCTCCTTCTCGGGG + Intergenic
985716949 5:1468051-1468073 CCTCCACCGGCTCCTCCTTGCGG + Intronic
985775811 5:1841171-1841193 CCTCCCCCTCCTGTCCCCTGAGG - Intergenic
986634594 5:9808903-9808925 CCTGCTCCTCCTGCTCCATGGGG - Intergenic
987093159 5:14525379-14525401 CCTCCCTCTCCTTCCCCCTGGGG + Intronic
990214335 5:53513937-53513959 ACACCCCTTCCTTCTGCTTGAGG - Intergenic
990464797 5:56061683-56061705 CCTCCCCTTCCATTCCCTTGGGG + Intergenic
990997288 5:61745459-61745481 CCACCTCCTCTTTCTCCATGTGG - Intronic
991457113 5:66815934-66815956 CCTCCTCCTTTTCCTCCTTGAGG - Intronic
991590966 5:68251029-68251051 CCTCCCTTTCCTTCTCCCTTGGG - Intronic
991663554 5:68974165-68974187 TCACCCCTTCCTTCTACTTGAGG + Intergenic
992981696 5:82181533-82181555 TCTCCCCCTCCATCTCACTGAGG - Intronic
993546420 5:89218436-89218458 CCTCCCTTTCCTGCTCCTTCAGG + Intergenic
995193119 5:109340661-109340683 CCTCCCCCTCCCTCTCCCCACGG + Intronic
996208167 5:120769335-120769357 TCTCCCCCTCCCTCTTTTTGTGG + Intergenic
996544014 5:124658705-124658727 CTTCCTCCTCCCTCTCTTTGTGG + Intronic
997419085 5:133751643-133751665 CCTCCCCCTCCATCTGCTACCGG - Intergenic
997577982 5:134997416-134997438 CCTCCCTCTCCTTCTCTTCATGG + Intronic
998157533 5:139795406-139795428 CCGCCCCCTCCTTCACCTCCAGG + Intergenic
998199424 5:140107860-140107882 CCTCCTCCTCCTTCCCCTGCGGG - Intronic
998359676 5:141573979-141574001 CCTCCACCTCCTTTGCCTGGGGG - Exonic
998379987 5:141717491-141717513 TCTCCCCCTCCTCCTCCTTCAGG - Intergenic
998849929 5:146342740-146342762 CCTCCACCTCCCTCTCCATCGGG + Intergenic
999145438 5:149390219-149390241 CCCCCCCCTCCCTGTCCCTGGGG + Intronic
999279749 5:150357555-150357577 TCTCCGCCCCCTTCGCCTTGAGG + Intergenic
999455822 5:151714856-151714878 CCTCCCCCTCCCTCTCCCCACGG - Intergenic
1000303045 5:159972598-159972620 CCTCCCCCCGGTTCCCCTTGGGG - Intergenic
1000361543 5:160452347-160452369 CCTCCTGCTACTTTTCCTTGGGG + Intergenic
1000992788 5:167928105-167928127 CCTCTCCCTCCTTCTTCTCTGGG + Intronic
1001395841 5:171419409-171419431 CCTCCTCCTCCTTCTCCTGGCGG - Intergenic
1001495993 5:172188105-172188127 ACTCCTCCTCCTTCTCCTCGCGG - Exonic
1001561965 5:172675621-172675643 CCTTCCCTCCCTTCTCCCTGTGG + Intronic
1002184177 5:177446675-177446697 CCTCCCCCTCCTTCCCTCCGGGG + Intronic
1002299266 5:178248221-178248243 ACTCCCCCTTCTCCCCCTTGAGG + Exonic
1002408159 5:179052633-179052655 CCTGCGCATCTTTCTCCTTGCGG + Intergenic
1002690268 5:181045564-181045586 CCTCCTCCTCCTTCAGCCTGGGG + Exonic
1002802133 6:533692-533714 CCTCCCCCCTCTTCTTCTTCTGG - Intronic
1003445262 6:6178034-6178056 CCCCCCCCCCCCTCTCCCTGTGG - Intronic
1003498913 6:6687805-6687827 CCTCTCCCTCCTTCCTTTTGGGG + Intergenic
1003843731 6:10150358-10150380 CCTCCTCTTCCTATTCCTTGTGG + Intronic
1005483714 6:26279261-26279283 CCTCCCACTACTTCCCCTGGAGG - Intergenic
1005734277 6:28731170-28731192 GCTCCCTCTCCTGCTCCTTAAGG - Intergenic
1005941458 6:30563286-30563308 CCTCCCCATTCTTCTCCTGTTGG + Exonic
1006024795 6:31139891-31139913 CCTCCCTCCCATTCTCCTTTTGG + Exonic
1006026449 6:31150215-31150237 TCTCCCACTCCTTCTCCCTCAGG - Exonic
1006431505 6:34000173-34000195 CCTCCCCTTCCTTCCCTCTGGGG - Intergenic
1006643716 6:35502065-35502087 ACTCCCTCACCTTCTCATTGAGG + Intronic
1006847426 6:37072284-37072306 CTGCCCCCTCCTTCTACATGTGG - Intergenic
1007321570 6:41032046-41032068 CCTTCCGCTCCTTCTGCTTCCGG - Exonic
1007732852 6:43959884-43959906 CCTCCTCCGCCTACTCCATGTGG + Intergenic
1007865167 6:44960331-44960353 CCTCCTCCTCCTCCTCCTCCTGG - Intronic
1007897497 6:45377806-45377828 CCACCCCCACATTCTCCTCGCGG - Exonic
1008222673 6:48874700-48874722 CCTCCTCCTCCTCCTCAGTGTGG - Intergenic
1008648979 6:53544657-53544679 CCTCCTCCTCCTCCTCCTCCGGG + Exonic
1008990474 6:57595887-57595909 CAGCCCCCTCCTTTTCCTGGAGG + Intronic
1009053409 6:58306211-58306233 CCTCCCCACTCTTCTCCTTAGGG - Intergenic
1009179048 6:60494433-60494455 CAGCCCCCTCCTTTTCCTGGAGG + Intergenic
1009237704 6:61144330-61144352 CCTCCCCACTCTTCTCCTTAGGG + Intergenic
1009968092 6:70598498-70598520 TCTCCCCCTTCTTCTCTTTATGG + Intergenic
1010527318 6:76918400-76918422 CCTCCCTCTCCTCCTCCCTTTGG - Intergenic
1010799725 6:80161561-80161583 ACTCCCCCTCCTTGTCCTTATGG + Intronic
1011474381 6:87736831-87736853 CCTCCCCCTCCCTCTCCCCACGG - Intergenic
1012178503 6:96120859-96120881 ACTCCATCTACTTCTCCTTGTGG - Intronic
1013348640 6:109286555-109286577 CCTGGCCCTACTTCTCCCTGGGG + Intergenic
1013422114 6:109976782-109976804 GCTCCCCCTACTTCTCCCTGTGG - Intergenic
1013958386 6:115867771-115867793 TCTTCCCCTCCTTCTGCCTGGGG + Intergenic
1014947611 6:127516109-127516131 CCTCCTCCCCCTTCTCCGAGCGG + Exonic
1015027850 6:128558426-128558448 CCTCACCTTCCTTCCCTTTGAGG - Intergenic
1015250895 6:131126629-131126651 CTTTCCCCTGCTTCTCCATGAGG - Intergenic
1015919490 6:138252613-138252635 CTTCCACCCCCTTCTCCTGGGGG + Intronic
1017192222 6:151666724-151666746 CCTCCTCCTCCTCCTCCTCCAGG + Intronic
1017557932 6:155593111-155593133 CCTTCCACTCTATCTCCTTGTGG - Intergenic
1017818020 6:158028973-158028995 CATCCCCCTGCTTCTGCGTGCGG - Exonic
1018323218 6:162635307-162635329 CCTTCCCCTCTTTCTCATTCTGG + Intronic
1018647938 6:165965220-165965242 CCTCGCCATCCCTCTCCTCGGGG - Intronic
1018707883 6:166476150-166476172 CCTCCGCCTCCATCTCCATGTGG - Intronic
1019084099 6:169457968-169457990 CCTCCTCCTCCTCCTCCGTCAGG - Intronic
1019175633 6:170158001-170158023 CCTCTCCCACCGTCTCTTTGTGG - Intergenic
1019175727 6:170158460-170158482 CCTCCCCCACCATCTCTTGGTGG - Intergenic
1019345080 7:525718-525740 CCTCCAGCCCCTTCTCCATGAGG - Intergenic
1019660026 7:2219093-2219115 CCTCCCCCTCCTTCTTAGAGAGG - Intronic
1019715935 7:2539410-2539432 CCTCTGCCTCCATCCCCTTGTGG + Intronic
1019726737 7:2606898-2606920 CGTCCCCGTCCATCTCCTCGGGG - Intronic
1020066747 7:5194182-5194204 CCTCCACCTCCATATCCCTGTGG - Intronic
1020119482 7:5495162-5495184 CCTCCCCATTCTGCTCCCTGAGG + Intronic
1020311528 7:6872279-6872301 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1021321931 7:19223106-19223128 CCTCCCTCCCTTTCTCCTTTTGG + Intergenic
1021952172 7:25785764-25785786 CCTCCCTCATCCTCTCCTTGAGG - Intergenic
1022453154 7:30534392-30534414 GCTCCTCCTCATTCTCCGTGTGG - Intronic
1022657268 7:32330954-32330976 CCTCCTCCTCTGTCTCCTTGGGG + Intergenic
1024359999 7:48458414-48458436 ACTCCCTCTCTTTCTCCTTAGGG + Intronic
1024520880 7:50303834-50303856 CGTCCCCCTCCCCCTCCTGGCGG + Intergenic
1027225637 7:76242071-76242093 CCTCTCCCTCTTTCTCCCTCTGG - Intronic
1027233048 7:76282958-76282980 CCTCGCCGTCCTTGTCCCTGCGG - Exonic
1028148997 7:87350671-87350693 CATGCTCATCCTTCTCCTTGGGG - Intronic
1028155173 7:87421320-87421342 CCTCCCCCTCCATTTGCTGGCGG + Intronic
1028488648 7:91386903-91386925 CCCCCCTCTACTTCTCCATGAGG - Intergenic
1029139465 7:98400336-98400358 CCTCCCCCTCCCCCTCCTCTTGG - Intronic
1029350847 7:100011850-100011872 CCTCCCCTTCCCTCTCCCTGGGG - Intergenic
1029532393 7:101134062-101134084 CCTCCCCCTGTTTCTGCTGGAGG + Intronic
1029546246 7:101212020-101212042 CCTCCCTCCTCTTCTCCTGGGGG - Intronic
1029629882 7:101743706-101743728 CCTCCTCCTCCTCCTCCTCCGGG + Intergenic
1029926996 7:104328745-104328767 CCTCCTCCTCCTCCTCCTCCTGG - Exonic
1030807545 7:113936391-113936413 CTTCCTTCTCCATCTCCTTGAGG + Intronic
1031160105 7:118156216-118156238 CCTCCCCCTATTTTTTCTTGTGG - Intergenic
1031599820 7:123692777-123692799 CCTCCTCCTCCTCCTGCTAGGGG - Exonic
1031868053 7:127061614-127061636 CCTCCCCCTGCTGATGCTTGTGG + Intronic
1031907252 7:127474429-127474451 CTTCCCCCTACTTCTCTTTGAGG + Intergenic
1032157084 7:129477183-129477205 CCTCCCCCTCCCTCTCCCCACGG - Intronic
1032526722 7:132583410-132583432 CCTCCACACCATTCTCCTTGAGG + Intronic
1032533683 7:132643086-132643108 CTTCCCCCTCCTCCTCCTGCAGG - Intronic
1032543619 7:132724457-132724479 CCTCCAGCCCCTTCTCCATGTGG + Intronic
1033159292 7:138981817-138981839 CCTCTCCCGCCGACTCCTTGCGG + Intergenic
1033361860 7:140643610-140643632 CCCCTCCCTCCTTCACCTTGTGG + Intronic
1034295648 7:149969932-149969954 CCACCCCTTCCAGCTCCTTGGGG - Intergenic
1034375980 7:150644574-150644596 CCTCCTCCTCCTCCTCCTTTTGG + Intergenic
1034590950 7:152138426-152138448 CATCCCCGTCCTTCTCCAAGGGG - Intronic
1034810413 7:154126973-154126995 CCACCCCTTCCAGCTCCTTGGGG + Intronic
1034893485 7:154860188-154860210 CCTGCCCCACCTTCTCCCTGAGG + Intronic
1034960626 7:155362204-155362226 CCTCCTCCTGCAGCTCCTTGGGG - Intronic
1035009166 7:155697182-155697204 CCTCCTCCTCCTCCTCCAGGAGG - Intronic
1035173299 7:157032888-157032910 CCTCCCATTCATTCTCCTGGGGG + Intergenic
1035411255 7:158644485-158644507 CCTCCCTATCCTTCCCTTTGAGG + Intronic
1035955313 8:4071187-4071209 TCTCCCTCTCTTTCTCCTTCCGG + Intronic
1036239805 8:7072124-7072146 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1036262072 8:7249030-7249052 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036288272 8:7463458-7463480 CGTCACCAGCCTTCTCCTTGTGG - Exonic
1036304518 8:7590528-7590550 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036314111 8:7707569-7707591 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036333203 8:7848070-7848092 CGTCACCAGCCTTCTCCTTGTGG + Exonic
1036355371 8:8038520-8038542 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036637248 8:10559774-10559796 CCTCCCCTCCCTTCTCCTCAGGG + Intergenic
1036705508 8:11043396-11043418 CCTCCTCTTCCTGCTCCTTCAGG + Intronic
1036787389 8:11697289-11697311 CCTCCCACTCCATTTCTTTGCGG - Intronic
1036816637 8:11907493-11907515 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036903527 8:12689441-12689463 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1037053799 8:14410221-14410243 CCTCCCTTTCCTTCTGCCTGTGG + Intronic
1037706676 8:21321371-21321393 CCTCCCACCCCTACTTCTTGAGG + Intergenic
1038388159 8:27168848-27168870 CCACGCCCTCCCTCTACTTGTGG + Intergenic
1039057479 8:33548321-33548343 CCTCCCCTTCCCACTCCTTCCGG - Exonic
1039230497 8:35441522-35441544 CCTCCACTTCCTTTTCCTGGTGG + Intronic
1040521377 8:48178978-48179000 ACCCCACCTTCTTCTCCTTGTGG + Intergenic
1040545380 8:48394723-48394745 CCTCTCCCTGCTCCTCCATGAGG + Intergenic
1040549376 8:48426914-48426936 CCTTCCCCTCCCTCGCCTCGGGG + Intergenic
1040808087 8:51417612-51417634 CCTCCCCCTTTTTCCCCCTGGGG + Intronic
1041177531 8:55211999-55212021 CCTGCCCCTCCACCCCCTTGGGG - Intronic
1042829272 8:73009045-73009067 CCTCCTCCTCCTCCTCCTCGGGG - Exonic
1043364159 8:79512274-79512296 CCTCCCCCTCCTTTTTTTTGGGG - Intergenic
1043481486 8:80657132-80657154 CCTCCTCCTCCTTCTCCTGGTGG - Intronic
1043499503 8:80838669-80838691 CCTCCTCCTCCTCCTCCTCCAGG - Intronic
1043890278 8:85646012-85646034 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043891894 8:85658202-85658224 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043894210 8:85724495-85724517 CCTCACTCTTCTCCTCCTTGAGG - Intergenic
1043894566 8:85727580-85727602 CCTCACTCTTCTCCTCCTTGAGG - Intergenic
1043894922 8:85730665-85730687 CCTCACTCTTCTCCTCCTTGAGG - Intergenic
1043895278 8:85733750-85733772 CCTCACTCTTCTCCTCCTTGAGG - Intergenic
1043897398 8:85748058-85748080 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043897754 8:85751146-85751168 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043898110 8:85754231-85754253 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043899724 8:85766426-85766448 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043901331 8:85778619-85778641 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043901686 8:85781704-85781726 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043903296 8:85793894-85793916 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043904907 8:85806087-85806109 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1043906518 8:85818278-85818300 CCTCACTCTTCTCCTCCTTGAGG + Intergenic
1044738781 8:95304603-95304625 CCACCTTCTCCTTGTCCTTGGGG + Intergenic
1044913232 8:97084381-97084403 CCTCCCCCATCTTTTTCTTGAGG + Intronic
1044932017 8:97260129-97260151 CCCCCTCCTCCTTCTCCTGCTGG - Intergenic
1045184509 8:99823442-99823464 CCTCCTCCTCCTCCTCCTCATGG - Intronic
1045583201 8:103500719-103500741 CCTCCCCCTGCTTTTCTTGGGGG + Intergenic
1046088886 8:109474000-109474022 CCACTCCTTTCTTCTCCTTGAGG - Intronic
1046096687 8:109570952-109570974 CCTCCCTCTCCTGCTTCTTTAGG - Intergenic
1046479558 8:114797846-114797868 CCTGCCCCTCCTCCTCTTTTAGG - Intergenic
1046962750 8:120127268-120127290 CCATCCTCTCCTTCTCCCTGGGG + Intronic
1047486920 8:125339687-125339709 CATCCTACTCCTTCTCCTTCAGG + Intronic
1047999648 8:130367584-130367606 CCTCGGCCTCATTTTCCTTGTGG + Intronic
1048312756 8:133338412-133338434 CCTCTCCTTACCTCTCCTTGTGG - Intergenic
1048412136 8:134186133-134186155 TTACCCCCTCCCTCTCCTTGGGG + Intergenic
1049658343 8:143808731-143808753 CCTCCTCCTCCTCCTCCTTCTGG + Exonic
1049663946 8:143834849-143834871 CCTCCCGCACCTCCTCCCTGGGG - Exonic
1050766278 9:9139105-9139127 CCGCCCCCACCTTATCCGTGGGG + Intronic
1051506256 9:17830881-17830903 CCTCCTCCTCACTCTACTTGAGG - Intergenic
1051607874 9:18934272-18934294 CTGCCCCCTTCTTCTCCTTTTGG + Intronic
1051612444 9:18974451-18974473 GCTCTCCCTCCTTTTACTTGAGG - Intronic
1052262774 9:26537149-26537171 CCTACCCCACCTTCTCACTGGGG + Intergenic
1053210136 9:36220585-36220607 ACTCACCCTCCTGCTTCTTGTGG + Intronic
1053290261 9:36875111-36875133 CCTCCCACTGCTTCCCCATGTGG + Intronic
1053381045 9:37650351-37650373 CCACTCCCTCGGTCTCCTTGAGG - Intronic
1054752084 9:68917613-68917635 TCTCCTCCTCTTTCTCTTTGAGG - Exonic
1054903065 9:70389654-70389676 CCTCCCCTGCCTTCATCTTGTGG - Intronic
1055120939 9:72660024-72660046 CCTGCCTGTCCTTCTCCTTGAGG + Intronic
1055738477 9:79359599-79359621 CCTTCCCCTCCTCCTTCTTCTGG - Intergenic
1055924843 9:81499434-81499456 CCTTCCCCTCCTTCCCCTATTGG + Intergenic
1055944443 9:81680313-81680335 CCTCCCCCTCTTTCTGCCTTTGG - Intronic
1056207833 9:84337215-84337237 TCTGCCTGTCCTTCTCCTTGAGG + Intronic
1056424767 9:86465376-86465398 CCAATCCCTCCTTCTGCTTGAGG - Intergenic
1056901065 9:90600001-90600023 CCTCCCCCACCTTCTCTCTCAGG + Intergenic
1057047853 9:91899623-91899645 CCTCCCCATCTTTCTCCTTGGGG - Intronic
1057308210 9:93924799-93924821 CCTCCCCCTACTCCACCATGAGG - Intergenic
1058886378 9:109324451-109324473 CCTCCACCTCCTACTCCTTGGGG - Intergenic
1059006417 9:110407636-110407658 CCTCACCCTCCTTATCATTTGGG - Exonic
1059484566 9:114616938-114616960 CTTCCTCCTCCTTCTCCTCCTGG + Intronic
1060301045 9:122374840-122374862 CCTCCTCCTCCTACTCCTGGAGG - Intronic
1060411207 9:123401484-123401506 CGTACCCCTCTGTCTCCTTGTGG + Intronic
1060743863 9:126117122-126117144 CCTGCCCCTCCTGCTTCTGGCGG - Intergenic
1060905766 9:127303856-127303878 CCACCCCCTACTTATACTTGTGG - Intronic
1061109232 9:128555646-128555668 CCTCCCTCTCTTTCTCTTTAAGG + Intronic
1061765008 9:132876058-132876080 CCCCTCCCTCCTTGTCCCTGGGG - Intronic
1061902644 9:133680830-133680852 CCTCTCCCTCCTTGTCCTCCCGG - Intronic
1062279875 9:135747129-135747151 CCTCCGCTCCGTTCTCCTTGGGG - Intronic
1062332189 9:136049711-136049733 CCTCCTCGTCCTCCTCGTTGTGG + Exonic
1062451924 9:136619374-136619396 CCTCTTCCTCCTCCTCCTTCAGG - Intergenic
1062572615 9:137192583-137192605 CCTCCTCCTCCTCCTCCTGCTGG + Exonic
1062630461 9:137460956-137460978 CTGCCCGCTCCTTGTCCTTGTGG - Intronic
1203775290 EBV:69573-69595 CCTGCCCCTCTTTCTCTGTGGGG + Intergenic
1203528757 Un_GL000213v1:115975-115997 CCTCCTCATCTTTCTCCTTTTGG - Intergenic
1185530458 X:814395-814417 TCTCTGCCTCCGTCTCCTTGTGG - Intergenic
1185530518 X:814734-814756 TCTCTGCCTCCGTCTCCTTGTGG - Intergenic
1185705026 X:2260399-2260421 CCTCCATCTCCATCTCCATGTGG + Intronic
1185764625 X:2715455-2715477 TCTCTGCCTCCTTCTCCGTGGGG + Intronic
1185909941 X:3971983-3972005 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1187561211 X:20405452-20405474 CCTCCCCAACCTTCTTCTCGTGG + Intergenic
1188602822 X:31989956-31989978 CCTCCCTCCCCTCCTCCTTTCGG + Intronic
1190136585 X:47804472-47804494 CCTCCCCCTCCTCCTCCTCCGGG + Intergenic
1190425865 X:50334150-50334172 CCTGCACATCTTTCTCCTTGTGG + Intronic
1190737783 X:53267048-53267070 CCTCCTCCTCCTCTTCCCTGGGG + Intronic
1191930548 X:66366794-66366816 CCTTCTCCTCCTTCCCCTAGTGG + Intergenic
1192149508 X:68703499-68703521 CCTCCCTCTGGCTCTCCTTGGGG + Intronic
1192341280 X:70265576-70265598 CATCTCCCTCTTCCTCCTTGTGG - Intergenic
1192448075 X:71225040-71225062 ACACCTCCTCCTTTTCCTTGTGG - Exonic
1192726000 X:73752671-73752693 ACTCCCCTTCCTTCCACTTGAGG - Intergenic
1192784168 X:74321521-74321543 CCTCCCACTCCATCCCCTTCTGG + Intergenic
1193620683 X:83749945-83749967 CGTCCTCCTCCTCCTCCTGGGGG + Intergenic
1194806670 X:98337740-98337762 ACTCTTCCTCCTCCTCCTTGTGG + Intergenic
1195028807 X:100906409-100906431 CATCCCTCCCCTTCTCCCTGTGG + Intergenic
1195702929 X:107718273-107718295 CCTGCCCCTCTTGCTCCTTCTGG - Intronic
1195726467 X:107922568-107922590 CCTCCACCCCCTACCCCTTGTGG + Intronic
1197078961 X:122389028-122389050 CCTCCCTCTCTTTCTCTTTCTGG - Intergenic
1197446166 X:126553572-126553594 CCTTCCACTCCCTCTCCTTAGGG - Intergenic
1197692826 X:129522361-129522383 CTTCCGCCTCCCTCTCCTAGTGG - Intronic
1197726834 X:129782045-129782067 CCTGCCCCTGCTTCTCCTCTTGG + Intronic
1198246684 X:134838679-134838701 CCTCCCCCTCCCTCTCCCCACGG + Intronic
1198694820 X:139324684-139324706 ACACCCCTTCCTTCTGCTTGAGG + Intergenic
1199078255 X:143548501-143548523 CCTCACCCTCTTTCACCATGTGG - Intergenic
1199086125 X:143633189-143633211 CCTGCCCCTCCAGCTGCTTGTGG - Intronic
1199358262 X:146886321-146886343 CGACCCCATCCTTCTACTTGAGG + Intergenic
1199501639 X:148513518-148513540 CCTCCCCCTTCTTCTAATTTTGG - Intronic
1199615404 X:149651720-149651742 GGTCCCCCACTTTCTCCTTGGGG - Intergenic
1199820415 X:151440063-151440085 CCTCCGACTGCTTCTGCTTGTGG - Intergenic
1200009003 X:153107614-153107636 TCTCCACCTCCTTCTTCATGTGG - Intergenic
1200030597 X:153292308-153292330 TCTCCACCTCCTTCTTCATGTGG + Intergenic
1200282986 X:154794455-154794477 CCTCCTCCTCCTCCTCCAGGTGG - Intronic
1201555084 Y:15258830-15258852 CCTGCACATCTTTCTCCTTGTGG - Intergenic
1202127494 Y:21581380-21581402 TCTCCTCCTCCTTCTCAGTGTGG - Intergenic