ID: 923025481

View in Genome Browser
Species Human (GRCh38)
Location 1:230200517-230200539
Sequence TGAGCTGCCCTGTGAATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923025474_923025481 18 Left 923025474 1:230200476-230200498 CCTCATGTGGAGTCACCTAGTAT 0: 1
1: 0
2: 0
3: 7
4: 60
Right 923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG 0: 1
1: 1
2: 1
3: 8
4: 193
923025479_923025481 -8 Left 923025479 1:230200502-230200524 CCGCAGGCCAGGGTCTGAGCTGC 0: 1
1: 1
2: 5
3: 66
4: 433
Right 923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG 0: 1
1: 1
2: 1
3: 8
4: 193
923025476_923025481 3 Left 923025476 1:230200491-230200513 CCTAGTATGCACCGCAGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG 0: 1
1: 1
2: 1
3: 8
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923025481 Original CRISPR TGAGCTGCCCTGTGAATGAC TGG Intronic
900518475 1:3094479-3094501 CAAACTGCCCTCTGAATGACCGG - Intronic
902280008 1:15367449-15367471 TTAGCTCCCCTGCGAGTGACAGG - Exonic
903268010 1:22170042-22170064 TGAGAAGCCATGGGAATGACTGG + Intergenic
904601518 1:31675198-31675220 TGAGCAGCCCTGGGAAGGGCAGG + Intronic
905875852 1:41431768-41431790 GGAGCTTTCCTGGGAATGACAGG + Intergenic
906383431 1:45347192-45347214 GCAGCTGCCCAGTGACTGACTGG - Intronic
907127888 1:52067822-52067844 AGAGCTGTCCTGTGCATTACAGG + Intronic
907333463 1:53686023-53686045 TGAGCAGCCTGGTGGATGACAGG - Intronic
908435623 1:64102818-64102840 GGGGCTGCCCTGTGTATTACAGG + Intronic
910361761 1:86419522-86419544 TTACCTGCCCTGTGAAGAACAGG - Intergenic
913073878 1:115324730-115324752 TGGGCTGCCCTGTGAGTTTCCGG - Intronic
913943765 1:125137683-125137705 AAGGCTGCCCTGTGAATTACGGG - Intergenic
914464771 1:147917138-147917160 TGTGCAGCCATGTGAATGAGTGG - Intergenic
914850785 1:151312560-151312582 TGAGCTGTGCTGTGGAGGACGGG - Intronic
915281141 1:154822866-154822888 TAAGCTGCCCTGGGACTGAAAGG - Intronic
919014610 1:192016611-192016633 AAATCTCCCCTGTGAATGACAGG + Intergenic
919616992 1:199820339-199820361 TGAGCTGCCTTGAGAAAGGCAGG + Intergenic
920066114 1:203270945-203270967 TGAGATGCCCTGTGATAGAGTGG - Intronic
922665488 1:227465324-227465346 GGAGGTGCCCTGTGGATCACAGG + Intergenic
922852708 1:228747542-228747564 TCAGCTGCCCTGTGGAGGCCGGG - Intergenic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
923819027 1:237415077-237415099 TGGGCTGTCCTGTGCATGGCAGG - Intronic
924605786 1:245533697-245533719 TGAGATGCACTTAGAATGACGGG + Intronic
1062832189 10:613372-613394 TGAGCTGAGATGTGAATGTCTGG + Intronic
1065127186 10:22584940-22584962 GGAGCTGCCCTGTCACTCACCGG + Intronic
1066676770 10:37896230-37896252 TGAGAAGCCCTGTGAATGTAAGG + Intergenic
1067282512 10:44883143-44883165 TGAGCTGCCCTTTGAATGACAGG - Intergenic
1067493851 10:46743584-46743606 TGAGCTCCCCTTTGTATGTCTGG + Intergenic
1067600807 10:47596821-47596843 TGAGCTCCCCTTTGTATGTCTGG - Intergenic
1068257548 10:54532944-54532966 TGAGTTGCCCTGAGAAGGAATGG + Intronic
1069971501 10:72174198-72174220 TGAGCTGCAGTTTGAATGAGAGG - Intronic
1072306996 10:94117210-94117232 TGAGCTTCCCAGTGAATAAAAGG + Intronic
1075266217 10:121001376-121001398 TGAGTTGCACTTTGATTGACAGG - Intergenic
1078133676 11:8634924-8634946 TGTGCTGGCCTGTGAGTGCCAGG - Intronic
1081282924 11:41232334-41232356 TGAGCTGTACTGTGTATTACTGG + Intronic
1083751643 11:64764144-64764166 TTAGCTGCTCTGTGCCTGACAGG + Intergenic
1087328898 11:96755359-96755381 GTAGCAGCCCTGTGAAAGACAGG - Intergenic
1089851492 11:121500774-121500796 TGTTATGCCCTGTTAATGACAGG + Intronic
1091641281 12:2239479-2239501 AGAGCAGCCCTGGGAATGAACGG - Intronic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1097249015 12:57622145-57622167 GGAGATGCACTGTGAATTACAGG - Intronic
1099466019 12:82988797-82988819 AGAGGTCCCCTGTAAATGACTGG + Intronic
1101696073 12:107128228-107128250 TGTGCAGCCCTGAGAATGAAGGG - Intergenic
1102566142 12:113798649-113798671 ACAGCTGCCCTGAGGATGACCGG - Intergenic
1105254571 13:18734413-18734435 TGAGAAGCCCTGTGAGTGAAAGG + Intergenic
1105494028 13:20914641-20914663 TGAGATTCCATATGAATGACAGG - Intergenic
1108704564 13:52973574-52973596 GGAGCAGCCCTGTGTGTGACTGG - Intergenic
1109238449 13:59852864-59852886 TTACCTGCACTGTTAATGACAGG + Intronic
1109875977 13:68405163-68405185 TCTGCTGCCATGTGAAGGACTGG - Intergenic
1110577528 13:77076439-77076461 TGAGCTGAACTGTGAAGGACAGG + Intronic
1112794904 13:103046337-103046359 TGATCTGCCATGTGAATCATAGG - Intronic
1113722737 13:112572953-112572975 TGAGCTTCCTTGTGGAGGACAGG - Intronic
1113868159 13:113542745-113542767 TGAGATGCCCTGTGCTTTACAGG + Intronic
1114950738 14:27749639-27749661 TGAGTATCCCTGTGATTGACAGG + Intergenic
1116307334 14:43275071-43275093 TCAGCTGGCCTGGGAATCACAGG - Intergenic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1118824695 14:69369511-69369533 TGAGCTCCACTGTGAACCACTGG + Intergenic
1122731629 14:103803868-103803890 TGACCTGACCTGAGAAAGACTGG + Intronic
1129515075 15:76152346-76152368 TGAGCTGGCGTGAGAATGAAAGG + Intronic
1130001874 15:80054831-80054853 GGGGCTGCCCTGTGCATTACAGG + Intergenic
1131328096 15:91468636-91468658 TGGCCTGCCCTGTGAATTTCAGG - Intergenic
1131580019 15:93634196-93634218 TGAGCTGCTCTCTGACTCACAGG + Intergenic
1133210447 16:4260647-4260669 TGAGCTGCTGTGAGACTGACAGG - Intronic
1133708016 16:8373958-8373980 GGATCTGCACTGTGAATGCCTGG - Intergenic
1135173853 16:20210636-20210658 TGACCTGCCCTGGGCATGAAGGG + Intergenic
1136022607 16:27449563-27449585 TCACCTGCCCTGTGCATGTCTGG + Exonic
1136948518 16:34686762-34686784 AAAGCTGCCCTGTGAAATACGGG - Intergenic
1138363284 16:56451303-56451325 TGCGCTGTCCTGTTAATGGCGGG - Exonic
1138619389 16:58198669-58198691 TGAGGAGCACTCTGAATGACGGG - Intergenic
1141323645 16:83035644-83035666 TGAGCTGGACTTTGAAGGACGGG + Intronic
1142231516 16:88902286-88902308 TTGGCTGTCCTGTGAATCACCGG - Intronic
1144960361 17:19041168-19041190 ACTGCTGCCCTGAGAATGACTGG - Intronic
1144974798 17:19133356-19133378 ACTGCTGCCCTGAGAATGACTGG + Intronic
1150213176 17:63452676-63452698 TCAGCTGCTCTGTGAGTGCCAGG + Intergenic
1152030724 17:77841158-77841180 TGAGCTGCCTTGTGAGGGAGTGG - Intergenic
1152195974 17:78918561-78918583 TGAGCTGCCCTGAGATTGCTGGG - Intronic
1154436457 18:14346207-14346229 TGAGAAGCCCTGTGAGTGAAAGG - Intergenic
1157688755 18:49664095-49664117 TGAGCAGCACTGTGAGTGGCTGG - Intergenic
1157794888 18:50564329-50564351 GGAGCTGTCCTGTGCATTACAGG + Intronic
1159012759 18:63073673-63073695 TGGCTTGGCCTGTGAATGACAGG + Intergenic
1160194053 18:76738401-76738423 AGAGCAGCTCTGTGAATGAGAGG + Intergenic
1162239929 19:9342918-9342940 TGAACGGCCCTTTGAATGTCAGG + Exonic
1163384920 19:16993711-16993733 TGCGATGCCCTGTGAATTTCAGG - Intronic
1166896927 19:46029118-46029140 AGGGCTGCCCTGTGACTGACAGG - Intergenic
1167231439 19:48286860-48286882 TGAGAAGCCCTGTGAATGAAAGG + Exonic
1168259904 19:55187501-55187523 TGTGCTGCCCTGTGAGTCTCGGG - Exonic
926719603 2:15949866-15949888 GCATCTGCCCTGTGACTGACAGG + Intergenic
926978122 2:18535170-18535192 TGAGTTGGCCTGTGAAGCACGGG - Intergenic
928227493 2:29464774-29464796 GGAGCTGTCCTGTGAATTATAGG - Intronic
934486602 2:94719855-94719877 TGAGTATCCCTGTGATTGACAGG - Intergenic
934489536 2:94751280-94751302 TGAGAAGCCCTGTGAGTGAAAGG + Intergenic
936838754 2:116742397-116742419 GGAGCTGTCCTGTGCATTACAGG + Intergenic
937147180 2:119657458-119657480 TGTCCTGCCCTGTGAGTGAAGGG - Intronic
938664801 2:133523852-133523874 GGAGCTGCCTTGTCAACGACAGG - Intronic
939262912 2:139833307-139833329 TGAGCTGGGATGTGAATGAAAGG + Intergenic
942327188 2:174785920-174785942 TGAAGGTCCCTGTGAATGACCGG + Intergenic
943141897 2:183993251-183993273 TGAGCAGTTCTCTGAATGACTGG + Intergenic
946172344 2:217902828-217902850 TGGGCTGCCCTCTCACTGACGGG + Intronic
946472755 2:219977975-219977997 TTAGCTGCCCTGTAAAAGATGGG + Intergenic
1169499782 20:6148220-6148242 TGTGCTGCCCTGTGTCTCACAGG - Intergenic
1171143214 20:22760625-22760647 TCAGCTGCTCTGTCACTGACAGG - Intergenic
1171879477 20:30607241-30607263 TGAGAAGCCCTGTGAATGAAAGG + Intergenic
1172020925 20:31913538-31913560 AGGGCTGCCCTGTGACTGGCTGG - Intronic
1172131660 20:32660133-32660155 TGGGCTGCCCTGTACAGGACAGG - Intergenic
1172657336 20:36545120-36545142 GGAGGTGCCCTGTAAATGATTGG - Intronic
1173966319 20:47115424-47115446 TGAGCCTCCCAGTGAATAACAGG - Intronic
1174746836 20:53072030-53072052 GGGGCTGCCCTGTGCATTACGGG - Intronic
1174773840 20:53325485-53325507 TGAACTGCCCTGTGTTTCACTGG - Intronic
1174816539 20:53692029-53692051 TGAGCTGGTCTGTGAATGGTTGG + Intergenic
1175908124 20:62391818-62391840 TGAGCTGCCCTCTGGAACACTGG + Intronic
1175912120 20:62410026-62410048 CGAGCTGCCCTGTGGCTGCCAGG + Intergenic
1176840586 21:13839445-13839467 TGAGAAGCCCTGTGAGTGAAAGG + Intergenic
1179117961 21:38511797-38511819 GGGGCTGCCCTGTGCATGGCAGG + Intronic
1179374069 21:40833882-40833904 GGAGCTGTCCTGTGCATTACAGG + Intronic
1179627613 21:42657573-42657595 TGAGCTGCCCATGGAGTGACAGG + Intronic
1180639121 22:17283814-17283836 TGACCTGCCCTGCGGATGTCAGG - Intergenic
1181064219 22:20298180-20298202 GGAGCTGCCCTGTGCATTGCAGG - Intergenic
1181138001 22:20782761-20782783 TGGGCTGCCCTGTGCATGGTAGG - Intronic
950232374 3:11287341-11287363 TGAGCTGCTCTGTGAATGCCAGG + Intronic
952815513 3:37443859-37443881 TCAGGTGCCCTGTGAAGGGCTGG - Intergenic
953493470 3:43368117-43368139 TGAGCCGCCCTGTGGGAGACAGG - Intronic
954116416 3:48469225-48469247 TGGGCTGCCGTGTGAGTGGCAGG + Intronic
954125392 3:48525168-48525190 GGAGCTGGCCTGGGAATGCCAGG + Intronic
956405744 3:68926951-68926973 GGAGCTGCCCTGTGCACAACAGG + Intronic
957841661 3:85678926-85678948 GGGGCTGCCCTATGAATGGCAGG - Intronic
958040665 3:88222147-88222169 TGAGCTGCTCTGTGAAGAAGAGG - Intergenic
959334825 3:105050939-105050961 TGAGCTGAGCTGTGAAAGCCTGG - Intergenic
959903847 3:111689166-111689188 TGAGCTGGACTGTGAGAGACAGG + Intronic
960022591 3:112971891-112971913 TGAGCTAGGCTTTGAATGACAGG - Intronic
961366711 3:126404653-126404675 TTCCCTGCTCTGTGAATGACCGG - Intronic
963636524 3:147804259-147804281 TGAGCTTCCCTGTGCATTATAGG - Intergenic
965824238 3:172714525-172714547 TGAGCTGACATCTGCATGACAGG + Intergenic
967345112 3:188446763-188446785 TGAGTTGCCCAGGGAATGATTGG + Intronic
968090979 3:195898003-195898025 GGAGCTGCCCTGTAAATGTCTGG - Intronic
968439750 4:617256-617278 GGCGCTGGCCTGTCAATGACGGG - Intergenic
973331415 4:48913471-48913493 TGAGAGGCTCTGTGAATCACAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
976576772 4:86681465-86681487 GGAGCTGCCCTGTAAATTGCAGG - Intronic
978856295 4:113398328-113398350 TGAGCTGGCCTGCGAAGGACTGG - Intergenic
984950281 4:185002898-185002920 AGAGGTGTCCTGTGGATGACAGG - Intergenic
990334999 5:54763940-54763962 GGAGCTGCCCTGTGCATGGTAGG - Intergenic
991300466 5:65124645-65124667 TGTCCTGCCCTGTGCATGAAGGG + Intergenic
991399576 5:66238995-66239017 TGAGCTGCCCTCTACACGACTGG - Intergenic
995553119 5:113299985-113300007 GAAGCTGCCCTGGGCATGACTGG + Intronic
998263152 5:140646531-140646553 TATGGTGCCCTGGGAATGACGGG - Intronic
999672115 5:153966938-153966960 TGAGCTGGGCTTTGAAGGACTGG - Intergenic
1001928479 5:175656813-175656835 TGAGCTGCTTTGTGAATTGCAGG + Intergenic
1004893516 6:20124502-20124524 TCACCTGCCTTGTGGATGACTGG - Exonic
1005839278 6:29730858-29730880 TGAGCTGGGCTGAGAATGGCGGG - Intronic
1007664135 6:43504757-43504779 TCAGCTGCCCTGTGAGCTACAGG + Exonic
1010774143 6:79865648-79865670 TGAACTGACCAGTGAATAACTGG + Intergenic
1013970382 6:116011033-116011055 AGAGCTGTCCTGTGATTAACTGG + Intronic
1014639703 6:123894201-123894223 TGAGCTGTCCTGTTCATGGCTGG + Intronic
1017959398 6:159208697-159208719 TGAGAAGCCCTGAGAATCACAGG - Intronic
1018195369 6:161351860-161351882 TAACCTGTTCTGTGAATGACAGG - Intronic
1018260983 6:161970322-161970344 TGAGCTGCCACGTGCATGCCTGG + Intronic
1019631012 7:2049841-2049863 TGAGGTGCCCTGTGAACGTGTGG - Intronic
1019631020 7:2049886-2049908 TGAGGTGCCCTGTGAACGTGTGG - Intronic
1019631036 7:2049976-2049998 TGAGGTGCCCTGTGAACGTGTGG - Intronic
1020135795 7:5587186-5587208 TGAGCTGCCCTGTGCAGGGGAGG - Intergenic
1022066285 7:26861402-26861424 TGAGCTGCCATATGCATTACAGG - Intronic
1022952971 7:35355970-35355992 TGATCTGCCATGTGACTGTCTGG + Intergenic
1023056666 7:36296173-36296195 TGGGCTGCCCATTGAATGCCAGG + Intronic
1025707101 7:63875820-63875842 TGTGCTGTACTTTGAATGACAGG - Intergenic
1026535938 7:71238593-71238615 TCGCCAGCCCTGTGAATGACTGG + Intronic
1027703117 7:81493853-81493875 TGAGCTGCCATTTGAAGGAATGG + Intergenic
1030771306 7:113477573-113477595 TGAGGTGCCCTGTGGTTGAATGG + Intergenic
1031306895 7:120139662-120139684 TGAGCTGCCTGGTGAATGCTTGG - Intergenic
1032478270 7:132226970-132226992 CAAGCTGCCCTGGGAAAGACAGG - Intronic
1032638776 7:133741292-133741314 TGAGCTGACCTGAGCATGCCAGG + Intronic
1032872173 7:135997986-135998008 GGAGCTGTCCTGTGCATTACAGG + Intergenic
1035770292 8:2141849-2141871 TGTGCTGCCCTGATGATGACTGG - Intronic
1037658454 8:20907290-20907312 TGAGATGCCCTGGGGATGAATGG - Intergenic
1038185576 8:25271439-25271461 TGAGCTGATCTCTTAATGACGGG - Intronic
1038210803 8:25517654-25517676 AGAGCTGCCCTATAAATGTCTGG + Intergenic
1041958533 8:63584262-63584284 TGAGCAGCCCCGTGAATGTATGG - Intergenic
1045533996 8:103010108-103010130 AGAGCTGCCCTGTGCATCCCAGG - Intergenic
1048725761 8:137381983-137382005 GGAGATGCCCAGAGAATGACTGG - Intergenic
1049835982 8:144735842-144735864 AGAGCTGCCGTGTGACTGAGAGG - Intronic
1051291826 9:15553030-15553052 TGGGCTGACCTGTGAAAGTCTGG + Intronic
1052261705 9:26524279-26524301 TGAGCTGCACCATGAAAGACAGG - Intergenic
1052380621 9:27767096-27767118 GGAGCTGCCCTGTGCATTAGAGG + Intergenic
1053668253 9:40332979-40333001 TGAGAAGCCCTGTGAGTGGCAGG - Intergenic
1053671194 9:40364437-40364459 TGAGTATCCCTGTGATTGACAGG + Intergenic
1053823745 9:41996979-41997001 TAAGGTGTCCTGTGAAGGACTGG + Intronic
1053918058 9:42959271-42959293 TGAGAAGCCCTGTGAGTGAAAGG - Intergenic
1053921003 9:42990817-42990839 TGAGTATCCCTGTGATTGACAGG + Intergenic
1054379395 9:64473030-64473052 TGAGAAGCCCTGTGAGTGGCAGG - Intergenic
1054382310 9:64504511-64504533 TGAGTATCCCTGTGATTGACAGG + Intergenic
1054513422 9:66011863-66011885 TGAGTATCCCTGTGATTGACAGG - Intergenic
1054516359 9:66043314-66043336 TGAGAAGCCCTGTGAGTGGCAGG + Intergenic
1054606826 9:67190379-67190401 TAAGGTGTCCTGTGAAGGACTGG - Intergenic
1057493085 9:95537871-95537893 AGAGGGGCCCTGGGAATGACGGG - Intergenic
1059292404 9:113238282-113238304 TGAGCTGTCTTGTGTATCACTGG - Intronic
1059529950 9:115026687-115026709 TGTCCAGCCCTGTGGATGACAGG + Exonic
1061116886 9:128619229-128619251 AGCGCTGCCTGGTGAATGACAGG - Intronic
1062587760 9:137257137-137257159 TCTGCTGCCCTGTGAATGATCGG + Intronic
1203416785 Un_KI270330v1:613-635 TGAAATGCCCTGTGAATGGAAGG - Intergenic
1203567989 Un_KI270744v1:108102-108124 TGAGAAGCCCTGTGAATGGAAGG + Intergenic
1203569049 Un_KI270744v1:115089-115111 TGAGAAGCCCTGTGAATGGAAGG + Intergenic
1186509337 X:10118666-10118688 GGTGCTGCCCTGTGCATGCCAGG - Intronic
1190569217 X:51764692-51764714 TGAGCTTCCCTGGAAATGGCTGG + Intergenic
1192843460 X:74881569-74881591 AGAGCTGCCCTGTGAATTTTAGG + Intronic
1193822080 X:86177601-86177623 TAAGATGCCAGGTGAATGACTGG - Intronic