ID: 923025587

View in Genome Browser
Species Human (GRCh38)
Location 1:230201342-230201364
Sequence CTCATCACAGCTGGTTGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923025587_923025593 -1 Left 923025587 1:230201342-230201364 CCACGGCAACCAGCTGTGATGAG 0: 1
1: 0
2: 1
3: 14
4: 133
Right 923025593 1:230201364-230201386 GATGGGGGTTCTGACCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923025587 Original CRISPR CTCATCACAGCTGGTTGCCG TGG (reversed) Intronic
903067989 1:20711485-20711507 CGCATCCCAGCTGGTTGCCATGG - Intronic
903301425 1:22381091-22381113 GTCATGACAGCTGGGTGCAGTGG + Intergenic
904080493 1:27869432-27869454 CTCCTCACAGCTGGTGGGGGCGG + Intergenic
904411245 1:30326159-30326181 CTCTGCACAGCTGGAGGCCGGGG + Intergenic
906312003 1:44760791-44760813 CTCAGCACTGCTGGCTGCCTGGG + Intronic
911085327 1:93972436-93972458 CACATCACAGCTGCCTGCCCTGG + Intergenic
913490910 1:119379136-119379158 GTCATCACATCTTGTTGCTGGGG - Intronic
916163773 1:161945896-161945918 CTCATCAAAGCAGGTGGCCAAGG - Intronic
917042830 1:170825214-170825236 CTAATCACAGCTGGGTGTGGTGG + Intergenic
917130048 1:171732231-171732253 CTCTTCTCAGCTGGGTGCAGTGG + Intronic
919904762 1:202070585-202070607 GTGATCACAGCTGGTTGCTCAGG + Intergenic
922187765 1:223291203-223291225 CTTATCACGGCCGGGTGCCGTGG + Intronic
923025587 1:230201342-230201364 CTCATCACAGCTGGTTGCCGTGG - Intronic
1062833503 10:621716-621738 CTCATCACAGCTCTGTGCAGTGG - Intronic
1065727280 10:28677964-28677986 CTCACCAAAGGTGGGTGCCGGGG + Exonic
1066288521 10:33992107-33992129 CCCAGCCCAGCTGGTTGCCCTGG - Intergenic
1069224119 10:65920475-65920497 CACATCACAACTGGGTGCCGGGG + Exonic
1070300511 10:75200454-75200476 CTCAGCACAGCTGGGCGCAGTGG - Intergenic
1074979752 10:118610072-118610094 CTCACCACACCTGGATGCCATGG + Intergenic
1077329880 11:1979565-1979587 CTCAGCACAGCCGGTGGCAGTGG + Intronic
1079958939 11:26898684-26898706 CTCATGATAGCTGTTTGACGTGG - Intergenic
1083236162 11:61352016-61352038 ATTATTACAGCTGGGTGCCGTGG - Intronic
1083250034 11:61460474-61460496 CTCATCACAGCGGGAGGCCCAGG - Intronic
1084468127 11:69339251-69339273 TTCATCCCAGCTGGATGCCCAGG + Intronic
1085955349 11:81386774-81386796 CTGAGCACAGCTGGATGCAGTGG + Intergenic
1088594241 11:111428008-111428030 TTTGTCACAGCTGCTTGCCGGGG - Intronic
1090278335 11:125435207-125435229 CTCAGCACTTCGGGTTGCCGAGG - Intergenic
1091095132 11:132813780-132813802 CTCATCTCAGCTGCTTCCCCCGG + Intronic
1202812858 11_KI270721v1_random:34744-34766 CTCAGCACAGCCGGTGGCAGTGG + Intergenic
1092266917 12:6988632-6988654 CTCATCAGAGTTGGCTTCCGTGG + Intronic
1096687670 12:53299632-53299654 CTCTGCAGAGCTGGTTGCCAAGG + Intergenic
1098360901 12:69653715-69653737 CTCAGGACAGCTGTTTGTCGTGG - Exonic
1099816585 12:87656518-87656540 CTTCTCACAGCTGGTTGCTATGG - Intergenic
1101871688 12:108571118-108571140 CTCATGACAGCTGCCTGCAGTGG + Intergenic
1101879013 12:108613902-108613924 CTCTACAGAGCTGGGTGCCGGGG - Intergenic
1104947229 12:132421475-132421497 CCCATCTCAGCTGGGTGCAGGGG - Intergenic
1105577661 13:21669163-21669185 CCCATCACTGCTGGCTGCCTCGG + Intergenic
1110651093 13:77941983-77942005 GTCAGCATAGCTGGTTGCAGTGG - Intergenic
1111792667 13:92878428-92878450 CTCTTCACAGCTGATTGCATAGG + Intergenic
1113653154 13:112052209-112052231 CTCATCACAGGTGATTCCAGGGG - Intergenic
1115279475 14:31645351-31645373 CACCTCACAGCTGGGTGCAGTGG - Intronic
1116838775 14:49797872-49797894 CTCTGCACAGATGGTAGCCGTGG - Intronic
1117863550 14:60120227-60120249 CACATCACAACTTGTTGCCAGGG - Intronic
1118987244 14:70767094-70767116 CTCATCCCGGCTGGGTGCGGTGG + Intronic
1119411800 14:74436559-74436581 CTCAGCTCAGCTGGGTGCAGTGG + Intergenic
1122711921 14:103664961-103664983 CACATCACTGCTGGGTGCTGGGG + Intronic
1127823603 15:62683317-62683339 TTGATCACAGCTGGCTGCCAGGG + Intronic
1128841742 15:70855884-70855906 CTCATCACAGGTGTTTGCAGAGG - Intronic
1131405257 15:92159197-92159219 TTCATCTCAGCTGGGTGCGGTGG + Intronic
1135573456 16:23566894-23566916 CTCATCAGGGCTGGTGGCTGCGG - Intronic
1135602313 16:23793884-23793906 GTCACCAAAGCTGGTTGCAGTGG + Intergenic
1136656996 16:31715406-31715428 TTCATCACAGCTGCTTCCCAGGG + Intronic
1137042305 16:35624343-35624365 CCCCTCACAGCTGGGTGCAGTGG - Intergenic
1139182295 16:64762413-64762435 CTAACCCCAGCTGGTTGCCCTGG - Intergenic
1139928527 16:70506107-70506129 CTCATCTCAGCCGGGTGCGGTGG + Intronic
1141759527 16:86018698-86018720 CTCACAACAACTGGTTGCCCAGG - Intergenic
1142067396 16:88070631-88070653 CTCATCACAGCTGCTCACCACGG + Intronic
1142613162 17:1120193-1120215 CTCATCACAGCTGCTTAGAGAGG - Intronic
1142976844 17:3649970-3649992 CCCACCACAGCTGGGTGCAGTGG + Intronic
1143237239 17:5413257-5413279 CTCATCTTGGCTGGTTGCAGTGG - Intronic
1143966872 17:10761845-10761867 CTGATCTCAGCTGGTTGGCTGGG - Intergenic
1144819116 17:18059067-18059089 CTCGTCACAGCTGGTTGTCATGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1146293849 17:31632988-31633010 CAGATCACAGCTGGGTGCAGTGG + Intergenic
1147690706 17:42312868-42312890 ATTATCACCGCTGGCTGCCGGGG + Intergenic
1149926865 17:60710102-60710124 GTCATCTCAGCTGGGTGCAGTGG - Intronic
1150828753 17:68499772-68499794 CTGATCACAGCTCTTTGCTGTGG + Intergenic
1151298418 17:73203058-73203080 CTCATCCCAGCTGGTGGCTGTGG - Exonic
1152445415 17:80339964-80339986 CTCCTCAAAGGTGGTTGCCGGGG - Exonic
1152999237 18:438523-438545 CTCATTCCAGCTGGGTGCTGTGG + Intronic
1154016169 18:10619889-10619911 CTCCTCACAGGGGGTTGCCGAGG - Intergenic
1154189345 18:12215760-12215782 CTCCTCACAGGGGGTTGCCGAGG + Intergenic
1160831849 19:1108023-1108045 CTCAGGACAGCTGGGGGCCGGGG - Exonic
1164551502 19:29216377-29216399 CTCAGCACGGCTGGTTGGGGGGG + Intergenic
1165672363 19:37690181-37690203 CTCTTCTCAGCTGGGTGCGGTGG + Intronic
1165927192 19:39334301-39334323 CCCATCTCGGCTGGGTGCCGTGG - Intronic
1168391954 19:56016438-56016460 CTCAGCACAGCTGGGTGTGGTGG - Intronic
926777208 2:16434397-16434419 CTCAGCATAGCTGGCTGCCCGGG + Intergenic
927765400 2:25802841-25802863 CTGATCACGGCTGGGTGCGGTGG + Intronic
929586927 2:43122097-43122119 CTACTCACAGCTGGTTGCTCAGG + Intergenic
930164598 2:48191996-48192018 CTGATCTCAGCTGGGTGCAGTGG + Intergenic
935784155 2:106533783-106533805 CTCAGGTCAGCTGTTTGCCGAGG - Intergenic
939773844 2:146359408-146359430 CTCATCCAAGGTGGTTGCCAGGG - Intergenic
1173806844 20:45931658-45931680 CTCTTCTCAGCTGGGTGCGGTGG - Intergenic
1176081532 20:63275832-63275854 CTCATCAGTGCTGGCTGTCGGGG + Intronic
1176238691 20:64065975-64065997 CCCTTCACAGCTGGTGGGCGGGG + Intronic
1180737781 22:18031430-18031452 TGCAACACAGCTGGGTGCCGTGG - Intergenic
1182492154 22:30680393-30680415 CTCATCTCGGCTGGGTGCGGTGG - Intergenic
1183770474 22:39921006-39921028 CTCAAGAGAGCTGGTTGCCCTGG + Intronic
1184969622 22:48006524-48006546 CACATGACATCTGGCTGCCGTGG + Intergenic
950083670 3:10241120-10241142 CTCATTACAGCTGGGTGCAGTGG + Intronic
950586297 3:13894995-13895017 CACATCACACCTGGATGCCCTGG - Intergenic
952064946 3:29558043-29558065 TTCATCCCAGCTTGTTGCCTTGG - Intronic
953492162 3:43361698-43361720 CACACCTCAGCTGGTTGCCCAGG + Intronic
954699062 3:52442189-52442211 CTCATCACAGTTGGCCACCGTGG - Exonic
956655249 3:71543538-71543560 CACATCACAGCTTGGTGCTGGGG - Intronic
961790249 3:129371005-129371027 CCCATCCCAGCTGCTTGCAGAGG + Intergenic
966641804 3:182199847-182199869 CGCATCACAGGTGGCTGACGGGG + Intergenic
968608075 4:1544977-1544999 CCCTGCACAGCTGGTGGCCGTGG + Intergenic
969866452 4:10079692-10079714 CTCATGACAGCTGGTGGCTTGGG - Intronic
974551912 4:63386307-63386329 CTAATTACAGATGGTTGCCAAGG + Intergenic
979372248 4:119902877-119902899 CAGATCACAGCTGGGTGCGGTGG - Intergenic
980802971 4:137776513-137776535 CTGATCTAAGCTGGGTGCCGGGG - Intergenic
982082929 4:151807841-151807863 CTCTTCACTGGTGGTTCCCGGGG + Intergenic
983040216 4:162915734-162915756 CTGATCACAGCTGGTCCCCCTGG - Intergenic
985127803 4:186712785-186712807 GTCATCACAGCTGGGTGATGAGG - Intronic
985606923 5:862815-862837 CTCCTGACAGCAGGTTGCTGTGG - Intronic
985723966 5:1506075-1506097 CTCATCAGCCCTGTTTGCCGAGG - Intronic
991911250 5:71563623-71563645 CTCTTCCCAGCTGGGTGCGGTGG + Intronic
994943437 5:106355376-106355398 CTCATCAAGGCTGGGTGCGGTGG + Intergenic
995841844 5:116449649-116449671 GACATCACAGTTGGTTGCTGTGG + Intronic
996623198 5:125535823-125535845 CTCATCTCACTTGGTTGCCCAGG - Intergenic
996892671 5:128440919-128440941 CTCATAATAGCTGGTTTCCATGG - Intronic
997471610 5:134120432-134120454 CTCATCACAGCCGAGTGCCTGGG + Intronic
997709242 5:135990147-135990169 CTCATCACAGCTGGTTGTGGAGG + Intergenic
1000571276 5:162916928-162916950 CTCAACAAAGTTTGTTGCCGTGG - Intergenic
1001094614 5:168766613-168766635 CTCATCACAGCCTGTGGCTGCGG + Intronic
1001912896 5:175535585-175535607 GTCATCTCAGCTGGTTTCCAGGG + Intergenic
1002043328 5:176529471-176529493 CTGAACACAGCTGGCTGCCGTGG - Intronic
1003140178 6:3464735-3464757 GTCATCACATCTGGGTGCAGTGG - Intergenic
1005111339 6:22285279-22285301 TTCATCACAGCTGGAAGCAGGGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015724752 6:136289022-136289044 TTCAAAACAGCAGGTTGCCGCGG + Intronic
1018220210 6:161570514-161570536 CTCTTCACAGCTAGTGGCTGAGG - Intronic
1020073557 7:5243114-5243136 CTCATCCCAGCTGGTGGCACAGG + Intergenic
1022355504 7:29610805-29610827 CTGAACACAGCTGGGTGCGGTGG - Intergenic
1027149209 7:75720749-75720771 CTCATCTCAGCCGGGTGCGGTGG + Intronic
1028088878 7:86672556-86672578 CTCATCTCAAGTGGTTGCCTGGG + Intronic
1030283411 7:107800205-107800227 CTCAGCACAGCTGGGTGCAGTGG + Intronic
1030617428 7:111752871-111752893 CTCATTTCAGCTGGGTGCCATGG - Intronic
1035472733 7:159120441-159120463 CTCATCACACCAGGCTGCCCTGG + Intronic
1039622750 8:39013787-39013809 CTCATAACAGCTGGGTGCAGTGG - Intronic
1039722321 8:40177367-40177389 CTCATCACTGCTGGTGACAGTGG + Intergenic
1041356205 8:57003411-57003433 CTCAACTCAGCTGGGCGCCGTGG - Intergenic
1044858823 8:96501593-96501615 CTTAACTCAGCTGGTTGCAGTGG - Intronic
1046848206 8:118942654-118942676 CTCATTAGAGATGGTTGCAGGGG - Intronic
1047752411 8:127891754-127891776 CTGGGCACAGCTGGTTGGCGTGG + Intergenic
1052371437 9:27669726-27669748 CTCATCTCAGCTGGGTGCCATGG + Intergenic
1052981365 9:34452152-34452174 TTCATCAAAGCAGGTTGCAGGGG + Intronic
1057233884 9:93343286-93343308 CTCATCAAGGCTGGTTACGGTGG + Intronic
1057251967 9:93510737-93510759 CTCATCAAGGCTGGTTACGGTGG - Intronic
1058219403 9:102278314-102278336 CTCATCACAGCCGGGCGCGGTGG - Intergenic
1061579735 9:131529662-131529684 GTCAGCACAGCTGGGTGCTGGGG + Intronic
1061662157 9:132137397-132137419 CTCTTCAGAGCTGGTTTCCCAGG - Intergenic
1186364481 X:8876706-8876728 GTCATGACAGCTGGTTGCCATGG - Intergenic
1189388475 X:40556705-40556727 GTCATCTCAGCTGGGTGCGGTGG - Intergenic
1192156418 X:68750159-68750181 CTCAGCACTGCTGTTTGCCAGGG - Intergenic
1192837270 X:74814141-74814163 ATCATCACAACAAGTTGCCGAGG + Intronic
1197873555 X:131082432-131082454 CCCACCTCAGCTGGCTGCCGGGG + Intronic