ID: 923026718

View in Genome Browser
Species Human (GRCh38)
Location 1:230210113-230210135
Sequence CGGGATCCAAACTCCTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923026718 Original CRISPR CGGGATCCAAACTCCTTTCC AGG Intronic
907883635 1:58574093-58574115 CAGGCTCCAAACTTCCTTCCAGG - Intergenic
911070032 1:93825217-93825239 AGGGCTCCAATCTCATTTCCAGG + Intronic
914389719 1:147209016-147209038 CAGGATCCAAGCCCCTCTCCTGG + Exonic
922458088 1:225793123-225793145 AGGTATCCAGACTCCTTCCCTGG + Intergenic
923026718 1:230210113-230210135 CGGGATCCAAACTCCTTTCCAGG + Intronic
924774900 1:247109566-247109588 AGGTATCCAAACTCCTTCTCGGG - Intergenic
1076941006 10:133608591-133608613 AGGGATCCAAACTCCTTCTCTGG - Intergenic
1079275175 11:19028891-19028913 CTTGAACCTAACTCCTTTCCTGG - Intergenic
1079877759 11:25881109-25881131 CAGATTCCAAACTCCTTTTCAGG - Intergenic
1084112020 11:67020377-67020399 TGGAAGCCAAACTCCTTTCTGGG - Intronic
1085117222 11:73940249-73940271 AGGGATCCAAACTCCTTCCCTGG + Intergenic
1090653811 11:128827327-128827349 CTGGATCCAGAATCCTCTCCTGG - Intergenic
1099107874 12:78519085-78519107 CTGGATTCAGACTCCTTTCCAGG - Intergenic
1100642731 12:96498159-96498181 CTGGATCAAAACCCCTTTTCTGG + Intronic
1104996557 12:132661443-132661465 CCTGATCCAACCTCCTTTCTGGG + Intronic
1105290781 13:19051610-19051632 CGAGAGGGAAACTCCTTTCCCGG + Intergenic
1111874347 13:93874567-93874589 AGGGATCCACACTTCTTACCAGG + Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113710987 13:112465412-112465434 GTGGCTCCAAACGCCTTTCCTGG - Intergenic
1114323297 14:21565048-21565070 CTGGATCCACACTCCCTTCAGGG - Intergenic
1118003751 14:61546904-61546926 AGTGATCAAAACACCTTTCCTGG + Intronic
1123510909 15:20998851-20998873 CTGTTTCCATACTCCTTTCCAGG - Intergenic
1123568131 15:21572610-21572632 CTGTTTCCATACTCCTTTCCAGG - Intergenic
1123604238 15:22007932-22007954 CTGTTTCCATACTCCTTTCCAGG - Intergenic
1125304532 15:38294908-38294930 GGGGATTCATAATCCTTTCCAGG + Intronic
1126396811 15:48227044-48227066 CTGGAACCAAACACCTTTCTTGG + Intronic
1128350798 15:66887070-66887092 CGGGTTGTGAACTCCTTTCCTGG + Intergenic
1132352135 15:101146455-101146477 CGGCATCACATCTCCTTTCCAGG - Intergenic
1202976489 15_KI270727v1_random:299698-299720 CTGTTTCCATACTCCTTTCCAGG - Intergenic
1133229147 16:4358298-4358320 CGGGACCCAAACTCCCCTCTAGG + Intronic
1136459700 16:30402081-30402103 TGTGATCCAAAGGCCTTTCCAGG + Intergenic
1139954146 16:70685415-70685437 CTGGATCCAAACCCCATTCATGG + Intronic
1146913077 17:36660479-36660501 AGGGATCCCATCTCCTTACCTGG + Intergenic
1151927502 17:77209696-77209718 AGAGATCCAATTTCCTTTCCAGG - Intronic
1154494869 18:14948244-14948266 TGGGCACCAAACTCCTATCCTGG + Intergenic
1159079486 18:63721458-63721480 TTGGATCCAAACTCCTTTCACGG - Intronic
1160310901 18:77789252-77789274 GGGGATCCCAACAGCTTTCCAGG - Intergenic
1161433216 19:4246458-4246480 CTGGATCCGGACCCCTTTCCTGG + Intergenic
1162016858 19:7850871-7850893 CGGGATCCTAACGCCTTCTCCGG + Intronic
1163962539 19:20710584-20710606 AGGGATCCAAACTCCTTCTCTGG + Intronic
1163989857 19:20988353-20988375 CGGGCTTCAACCCCCTTTCCAGG - Intergenic
1164156800 19:22602132-22602154 CTGGATCCTCACCCCTTTCCTGG + Intergenic
1164771659 19:30814342-30814364 CTGGTTTCAAACTCCTGTCCTGG + Intergenic
1166161620 19:40957953-40957975 AGGTATCCAAACTCCTTCTCGGG - Intergenic
1167557806 19:50206446-50206468 CCGGACCCAAACTCCATCCCTGG - Intronic
1167753901 19:51398711-51398733 AGGGATCCAAACTCCTTCTCTGG + Intergenic
1167881395 19:52461548-52461570 TGGTATCCAAACTCCTTCTCTGG + Intronic
1168624102 19:57903090-57903112 AGGGATCCAAACTCCTTCTCTGG - Intronic
928305246 2:30164630-30164652 CGGAAGCCAACCTCCTCTCCTGG - Intergenic
932485877 2:72084023-72084045 CAGGATCCATTCTCCATTCCTGG - Intergenic
933907926 2:86913913-86913935 CGAGATCCACTCACCTTTCCAGG - Intronic
933911108 2:86942300-86942322 CGAGATCCACTCACCTTTCCAGG - Intronic
934011642 2:87825644-87825666 CGAGATCCACTCACCTTTCCAGG + Exonic
935722678 2:105993430-105993452 AGGGATCCAAACTCCTTCCCTGG - Intergenic
936053616 2:109243772-109243794 CATGTCCCAAACTCCTTTCCTGG - Intronic
943562509 2:189480904-189480926 TGGGATCCAAAATCCTTCCCAGG - Intergenic
945992602 2:216408648-216408670 CTGGAGCCAGGCTCCTTTCCTGG + Intergenic
948393792 2:237630363-237630385 TGGTATCCAAATTCCTGTCCTGG + Intronic
1168962713 20:1879991-1880013 CGGGATTCAAACCCCCATCCAGG - Intergenic
1174637106 20:52010637-52010659 CTGGATCCAACCTCGTATCCAGG + Intergenic
1180041995 21:45284990-45285012 CGGGAGCCACACTCCTTGGCAGG + Intronic
1181738970 22:24904830-24904852 TGTTATCCAAACTCCTTTACTGG - Intronic
1182088020 22:27574786-27574808 CCGGCTCCAAACGCTTTTCCCGG - Intergenic
1182477780 22:30585574-30585596 TGGCATCCAAACTGCCTTCCAGG + Intronic
1184701914 22:46180912-46180934 GGAGAGCCAATCTCCTTTCCGGG - Intronic
949641057 3:6036364-6036386 CTGGCTTCAACCTCCTTTCCAGG + Intergenic
955873013 3:63459740-63459762 AGGGACCCATATTCCTTTCCGGG - Intronic
961173359 3:124814973-124814995 AGGGATCCACACTCCTCTCCTGG + Intronic
962381806 3:134904109-134904131 CTGGAGCCAGCCTCCTTTCCAGG - Intronic
967605082 3:191435368-191435390 CAGGAGCCAAACTGTTTTCCTGG + Intergenic
968217322 3:196904454-196904476 CATGATCCAAACTCTTTACCAGG - Intronic
969701173 4:8768644-8768666 TAGGATTCACACTCCTTTCCTGG + Intergenic
974257010 4:59470735-59470757 TGGGATCCAAAATCCTCTCCAGG + Intergenic
975819581 4:78256026-78256048 CTGGAGGCAAACTCCTTTCATGG - Intronic
980390020 4:132132722-132132744 AAGGAGGCAAACTCCTTTCCTGG + Intergenic
987114397 5:14714520-14714542 TGGGATAAAAATTCCTTTCCAGG + Intronic
991714880 5:69442363-69442385 TGGGATTCAAACACCTTTCAAGG - Intronic
995398725 5:111717167-111717189 CTGGCTTCAGACTCCTTTCCAGG + Intronic
996458897 5:123718413-123718435 CTGGATACAAAATTCTTTCCTGG + Intergenic
998787423 5:145727775-145727797 AGGGATCCAAACTCCTTCCCTGG + Intronic
1004687499 6:17961289-17961311 TGGAATCCCAGCTCCTTTCCAGG - Intronic
1015719002 6:136221822-136221844 TTGGATCCAAACACCTATCCAGG + Intergenic
1018783668 6:167091759-167091781 CCCGATCCCAACTCCCTTCCTGG - Intergenic
1019261197 7:82813-82835 CTGGATAAAAACACCTTTCCTGG - Intergenic
1019595907 7:1858310-1858332 CCGGACCCCAACTCCGTTCCTGG + Intronic
1032545512 7:132738399-132738421 CGTGGTCCAATCTCCTTTCTTGG + Intergenic
1033603116 7:142903518-142903540 CTGAATCCTAAGTCCTTTCCTGG - Intergenic
1034472656 7:151263870-151263892 CAGAATCCAAATTCCTTGCCAGG + Intronic
1039921055 8:41895152-41895174 CAGGCTCCAAACTTCTTTCTCGG + Intronic
1040122145 8:43695362-43695384 AGGTATCCAAACTCCTTCTCGGG + Intergenic
1041671742 8:60498557-60498579 AGGGATTCAGACTCCTTCCCTGG - Intergenic
1049877100 8:145031375-145031397 AGGTATCCAAACTCCTTCTCAGG - Intergenic
1052799385 9:32953465-32953487 CTGGATCAAGACTCCTTTTCCGG - Intergenic
1054808190 9:69412748-69412770 CAGGCCCCAGACTCCTTTCCCGG + Intergenic
1060822133 9:126667546-126667568 GGGGATCCAGACCCCTTTACTGG - Intronic
1187261214 X:17686769-17686791 CCAGATCCAGACTCCTGTCCTGG - Intronic
1190995707 X:55606470-55606492 CTGGCTTCAAACCCCTTTCCAGG + Intergenic
1192102854 X:68283453-68283475 AGGGATCCAAACTCGTTTCAGGG - Intronic
1196080776 X:111628119-111628141 CTGGATCCACAGTCCCTTCCTGG + Intergenic
1197279535 X:124518786-124518808 CTGGAGCCAGACTCCTTCCCCGG - Intronic
1200395553 X:155984700-155984722 AGGGAACCAAACTCCTTCCCTGG + Intergenic
1200982488 Y:9275051-9275073 AGGTATCCAAACTCCTTCTCAGG + Intergenic
1201402068 Y:13613984-13614006 AGGGATCCAAACTCCTTCTATGG + Intergenic
1202127913 Y:21584662-21584684 AGGTATCCAAACTCCTTCTCAGG - Intergenic