ID: 923028961

View in Genome Browser
Species Human (GRCh38)
Location 1:230231479-230231501
Sequence CTGTGTTATTGGACAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923028955_923028961 2 Left 923028955 1:230231454-230231476 CCTCCCAACACCGTGAAACAGCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 142
923028956_923028961 -1 Left 923028956 1:230231457-230231479 CCCAACACCGTGAAACAGCCTTC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 142
923028957_923028961 -2 Left 923028957 1:230231458-230231480 CCAACACCGTGAAACAGCCTTCT 0: 1
1: 0
2: 0
3: 16
4: 329
Right 923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 142
923028958_923028961 -8 Left 923028958 1:230231464-230231486 CCGTGAAACAGCCTTCTGTGTTA 0: 1
1: 0
2: 2
3: 19
4: 231
Right 923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 142
923028954_923028961 16 Left 923028954 1:230231440-230231462 CCTATTTCTTTGTTCCTCCCAAC 0: 1
1: 0
2: 3
3: 33
4: 392
Right 923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923028961 Original CRISPR CTGTGTTATTGGACAGAAGC TGG Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
909269989 1:73610760-73610782 CTTTTTTATATGACAGAAGCAGG - Intergenic
916401423 1:164452938-164452960 CTGAGTTACTGGACAGAACTAGG + Intergenic
916632958 1:166636924-166636946 CACTGTTACTGGAAAGAAGCAGG - Intergenic
918759474 1:188383824-188383846 TTGTGATATTGCACAGAAGCAGG + Intergenic
922412693 1:225391542-225391564 CAGTGGTAGTGGGCAGAAGCAGG + Intronic
923028961 1:230231479-230231501 CTGTGTTATTGGACAGAAGCTGG + Intronic
923059655 1:230459188-230459210 CTGGGTCATAGGACAGATGCTGG + Intergenic
923935298 1:238753322-238753344 GTGTGTTCTGTGACAGAAGCAGG - Intergenic
924684604 1:246275305-246275327 CTTTGTTGTTGGCCAGGAGCAGG - Intronic
1063435287 10:6024722-6024744 CTGTGTTGTTTGACAGCAGCAGG + Intronic
1064413982 10:15132964-15132986 CTGTGTTCTTGGACAATAACTGG - Intronic
1064798995 10:19047233-19047255 TTGGGTAATTGGACAGAAGAAGG + Intergenic
1065065355 10:21957957-21957979 ATATGTGAATGGACAGAAGCAGG - Intronic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1067686573 10:48469391-48469413 TTGTGTGATTGGACAGACTCAGG - Intronic
1069261776 10:66407373-66407395 ATGTGATATTGTACAGAAACAGG - Intronic
1072335672 10:94395836-94395858 CTGTGCTCTTGGCCAGGAGCAGG - Intergenic
1074145096 10:110710610-110710632 CAGTTTTCTTGGAGAGAAGCTGG + Intronic
1075211712 10:120496667-120496689 CAGTGTTATAGGACAGTACCTGG + Intronic
1075418016 10:122279835-122279857 CTGTCTGCTTGGACAGGAGCTGG + Intronic
1079122866 11:17697442-17697464 TTCTGTTCTTGGCCAGAAGCTGG - Intergenic
1079156200 11:17950058-17950080 CTGGGTATTTTGACAGAAGCTGG + Intronic
1079528714 11:21422584-21422606 TTATGTTATTGGAGTGAAGCTGG + Intronic
1081458195 11:43246254-43246276 CTGTATTGGAGGACAGAAGCAGG - Intergenic
1086015885 11:82167053-82167075 TCATGTCATTGGACAGAAGCTGG + Intergenic
1087111790 11:94477863-94477885 CTGGGCTTTTGGAAAGAAGCGGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1093901920 12:24645465-24645487 CAGTGTCATTTCACAGAAGCAGG + Intergenic
1104729518 12:131097331-131097353 CTGTGTGTTTGAACAGATGCTGG - Intronic
1106803633 13:33283075-33283097 CTGTGTTATTGGGTAGTAACTGG + Intronic
1107590688 13:41901326-41901348 CTTTGTAATTGGACAGAGCCTGG + Intronic
1108393435 13:49970720-49970742 TTGAGTTATAGGACAGAAGGTGG + Intergenic
1110440456 13:75520396-75520418 CTTTGGAACTGGACAGAAGCTGG + Intergenic
1110794822 13:79623968-79623990 CGGTGTTATTGAACAGAACTGGG - Intergenic
1112322588 13:98420959-98420981 CTGTGTATTTGGACCCAAGCAGG + Intronic
1120917410 14:89722121-89722143 CCGTGCGATTGCACAGAAGCTGG + Intergenic
1121491611 14:94365135-94365157 CTTTCTCATTGGACAGAAGGAGG + Intergenic
1121494360 14:94381712-94381734 CTTTCTCATTGGACAGAAGGAGG + Intronic
1126796192 15:52261987-52262009 CTGTGATATTGGTCAGCAGGGGG - Intronic
1129614035 15:77083943-77083965 CTGAGTGATCGGAGAGAAGCCGG - Intronic
1131199882 15:90387802-90387824 TTGTCTTGTTGGACACAAGCAGG - Intergenic
1132226337 15:100144749-100144771 GTGTGTTATTGTACCAAAGCAGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133018645 16:2956197-2956219 CTGTGTTGTTGCACAGGGGCAGG - Intergenic
1137548643 16:49421599-49421621 CAGTGTGATTGGACAGAGGCAGG + Intergenic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1143139485 17:4733228-4733250 CTGTGCCATGGGACAGAACCTGG + Exonic
1143847411 17:9783010-9783032 CTGTGGTATTGGAGAGATGGAGG + Intronic
1146367796 17:32242813-32242835 CTGTGTTACTGGAGAGCAACAGG + Intronic
1149016645 17:51916143-51916165 CAGTGTCATTGGCCAGAAGCTGG + Intronic
1153380107 18:4428621-4428643 GTGTCTTATGTGACAGAAGCAGG - Intronic
1154100019 18:11464376-11464398 CAGTATTGCTGGACAGAAGCGGG + Intergenic
1156611871 18:38734560-38734582 CAGTGTTATAAGACAGAAGCAGG + Intergenic
1158856692 18:61549964-61549986 CTGTGTTATCTGAAAGAAGGAGG - Exonic
1160224765 18:77004027-77004049 CAGTATTATTGGACAGAACATGG + Intronic
1164530186 19:29042614-29042636 CTTTGTGATTGGACAAAAGATGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1167717150 19:51150819-51150841 CTGTGTGATTAGACAGAGGGAGG + Intronic
1168126101 19:54284053-54284075 CTGTGTTTGTGGACAGACCCTGG + Intergenic
1168171186 19:54590736-54590758 CTGTATTTGTGGACAGAATCTGG - Intronic
1168175835 19:54627024-54627046 CTGTGTTTGTGGACAGACCCTGG - Intronic
925961402 2:9020484-9020506 ATGTGTTCTTGGCCAGAAGACGG + Intergenic
926119269 2:10232738-10232760 CTGTGTTGTGGGAGAGAAGGTGG + Intergenic
926176786 2:10600527-10600549 CTGTGTTATTTTAAAGAATCAGG + Intronic
927028652 2:19096992-19097014 CTTTGCAATTGGTCAGAAGCAGG - Intergenic
927693010 2:25221682-25221704 CTGTGGTATGGGACAGAAAGAGG + Intergenic
930102496 2:47614175-47614197 CTGTGTTAGTGGCCAGTTGCAGG - Intergenic
931061722 2:58536885-58536907 CTGTTTTAGTGGAGAAAAGCAGG + Intergenic
933678703 2:85079768-85079790 TTGTTTTATTGGAAAGAATCAGG + Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
936924486 2:117722523-117722545 CTGTTTTATTAGGCAGAAGGAGG + Intergenic
937726506 2:125173699-125173721 CTGGGTAATTGGGCAGAAGTTGG + Intergenic
939078480 2:137630936-137630958 CTGAGTTATTGGGCAAAACCTGG + Intronic
939465676 2:142552635-142552657 CTGTTTTATTGGCCATCAGCAGG - Intergenic
940467106 2:154044979-154045001 GTGTGTTATTGGTCAGTACCAGG + Intronic
942749581 2:179272719-179272741 CTGTGTTTTTGGACAAAATAGGG + Intergenic
943369986 2:187003603-187003625 CTGTGTTATTGGATATACCCGGG + Intergenic
945155675 2:206834825-206834847 CTGTTTTAGTGGTCAGAAGGTGG + Intergenic
945264000 2:207872266-207872288 CTGAGTTCCTGCACAGAAGCAGG + Intronic
945316471 2:208376680-208376702 ATGTGTCATTGGGTAGAAGCTGG - Intronic
948851498 2:240709946-240709968 CTGTGGTGTTGACCAGAAGCTGG + Intergenic
1168808993 20:690883-690905 CTGTCTTTTTGGACAGAACTGGG - Intergenic
1170869795 20:20195175-20195197 CTGTGCTTTGTGACAGAAGCTGG + Intronic
1170875602 20:20247180-20247202 ATGTGTTCTTGGCCAGAAGTTGG - Intronic
1172007740 20:31829048-31829070 CTGAGTTACTGGACAGATGGTGG + Intronic
1177979112 21:27888784-27888806 GTGTGTTAATGGACACAAGACGG - Intergenic
1182074538 22:27486966-27486988 ATGTTTTATTGGATAGAAGCAGG + Intergenic
1185066705 22:48635896-48635918 CTGTGAAATCCGACAGAAGCAGG - Intronic
1185087076 22:48746740-48746762 CCTTGTTACAGGACAGAAGCCGG + Intronic
950880198 3:16317064-16317086 CTGTGTTTCAGGACAGCAGCAGG - Exonic
952150297 3:30581652-30581674 CTGTGGGATTAGGCAGAAGCCGG + Intergenic
957951204 3:87129417-87129439 TTCTGCTGTTGGACAGAAGCTGG - Intergenic
959619294 3:108382713-108382735 CTGTGTTTTCGGGCAGAATCAGG - Intronic
959619333 3:108383077-108383099 CTGTGTTTTTGGGCAGAATCAGG + Intronic
960201961 3:114847750-114847772 CTGTGTTATTGCACAAGTGCTGG - Intronic
961417260 3:126768284-126768306 CTGTCTTACAGGGCAGAAGCAGG - Intronic
961859530 3:129904159-129904181 CTGTGTTATTGTCCAAGAGCAGG + Intergenic
963960156 3:151300730-151300752 CTTTGTGATTGGACAGAATGAGG - Intronic
964587137 3:158318629-158318651 CAGTGTTATGGGACAGAGGATGG - Intronic
964918815 3:161871064-161871086 CTTTGTAATAGGACAGAGGCAGG - Intergenic
965959110 3:174407624-174407646 CTGGGTTAAAGCACAGAAGCAGG + Intergenic
967666114 3:192174259-192174281 CAGAGATATTGCACAGAAGCTGG + Intronic
971290831 4:25337577-25337599 CTGTGTGATTGGTCAGAGGCTGG - Intronic
971672088 4:29574721-29574743 CTTTCTTATTGGAGAGAAGAGGG + Intergenic
972761166 4:42105876-42105898 CTGTGTGATTGAATAGAAGCAGG - Intergenic
976436840 4:85028158-85028180 CTTTGTTATTGATAAGAAGCTGG - Intergenic
982287189 4:153747732-153747754 CTGTGTAATTGGGCAGAGGCTGG - Intronic
982845928 4:160252576-160252598 CTGTGTTATAGTACAGAAGCAGG - Intergenic
984625466 4:182002560-182002582 TGGTCTTATTGGACGGAAGCAGG - Intergenic
987054913 5:14182180-14182202 CTGTGTTATTCCTCAGGAGCAGG + Intronic
990374123 5:55152198-55152220 CAGTTTCATTGGGCAGAAGCTGG - Intronic
991296102 5:65083265-65083287 CTGTGTAAGTGCCCAGAAGCTGG - Intergenic
992173307 5:74125029-74125051 CTGAGTAAGTGGACAGACGCAGG - Intergenic
992658915 5:78938873-78938895 ATGTGTTATTGAACAGGATCCGG + Intronic
993764596 5:91840531-91840553 CTGTTTTATTGGAAAAAAGGGGG - Intergenic
996124860 5:119712494-119712516 ATTTGTTATTGGAGAAAAGCAGG - Intergenic
996517249 5:124384456-124384478 GTATGTTATTGGAATGAAGCTGG + Intergenic
996866853 5:128133727-128133749 GTGTGTTTTTGGACAGCAGCAGG + Intronic
998751039 5:145321611-145321633 TTGTTTTATTGGACATAAGAGGG + Intergenic
998991403 5:147821839-147821861 CTGTGTGGTGGGGCAGAAGCTGG - Intergenic
999214631 5:149921960-149921982 CAGTGTTATTGGACATGAGAGGG + Intronic
1008227123 6:48934955-48934977 CTGAGTTATTGGCCTTAAGCAGG - Intergenic
1009553262 6:65127582-65127604 CTGTGTTATTGTCCTGAAACAGG + Intronic
1013890117 6:115016797-115016819 CTGTGTAATTGGGCAGCAGGGGG - Intergenic
1015888430 6:137944920-137944942 ATGCGTTATTGGTCAGACGCTGG + Intergenic
1017695736 6:157013845-157013867 CTGTGTTACTGAACAGACCCAGG - Intronic
1020191166 7:5999107-5999129 CTCTGTGTTTGGGCAGAAGCAGG - Exonic
1022060489 7:26788070-26788092 ATTTGTTATTGGTCAGAAGAAGG + Intronic
1022556136 7:31298754-31298776 CTGAGTAATTGGACAGATGAGGG + Intergenic
1022616985 7:31941549-31941571 CTGTGTTCTTTGACAGATCCAGG + Intronic
1022967973 7:35491705-35491727 TTCTATTATTGGAAAGAAGCAGG - Intergenic
1023793559 7:43772382-43772404 CGGTCTTATTGGCCAGAATCAGG + Intronic
1024831789 7:53468497-53468519 ATGTTTTATTGGACAAATGCTGG + Intergenic
1027343276 7:77232634-77232656 CTGTGTTACTGAGCAGGAGCTGG + Intronic
1027532660 7:79354614-79354636 CTCTCTTATTGGACAGAGGTAGG - Intronic
1028635455 7:92984355-92984377 CTGTGTTCTTGAGCAGAAGAAGG + Intergenic
1029557844 7:101282762-101282784 CTCTGTTTTTGGACAGCAGTGGG - Intergenic
1034411779 7:150945850-150945872 CTCTGTGTTGGGACAGAAGCTGG + Intronic
1034592183 7:152150692-152150714 CTTAGTTATTTGACAGAAGTGGG - Intronic
1037372795 8:18197820-18197842 GTGTCTTATTGGTCAGAACCAGG - Intronic
1037566632 8:20123609-20123631 CAGTTTCATTGGACAGAAGCAGG + Intergenic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1044419307 8:91974509-91974531 TTGTGATTTTGGACAGAAGAAGG - Intronic
1044799939 8:95943827-95943849 TTGTGTTATTGCACAGAACTAGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1050355772 9:4781439-4781461 CAGGTTTATTGGACAGCAGCTGG + Intergenic
1053311095 9:37020555-37020577 CTGTCATATTGGACAGCTGCTGG + Intronic
1055758664 9:79582864-79582886 CTGGGCTGTTGGAGAGAAGCAGG + Intronic
1056838585 9:89979030-89979052 GTGTGTTATTGAACAGCAGGTGG - Intergenic
1057064487 9:92036108-92036130 CTGTGATGATGCACAGAAGCGGG + Intronic
1186285229 X:8036388-8036410 CTGCATTATTAGATAGAAGCTGG - Intergenic
1189866216 X:45330252-45330274 CTGCCTTATTGGACAGAACTTGG + Intergenic
1195079566 X:101358166-101358188 CTGTGATACTGGGTAGAAGCTGG - Intronic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1199209326 X:145188255-145188277 CTATTATATTGGACAGAAGATGG + Intergenic
1200924422 Y:8641762-8641784 CTCTTTTATTGGACAGTTGCTGG + Intergenic