ID: 923029517

View in Genome Browser
Species Human (GRCh38)
Location 1:230236292-230236314
Sequence AGGGGTATAAACTTTTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923029517 Original CRISPR AGGGGTATAAACTTTTAGCC TGG (reversed) Intronic
904297286 1:29528240-29528262 AGGGGTATAAACTTCAAGCCAGG + Intergenic
905030597 1:34881326-34881348 TGGGGTATAGTCTTTTAGCTGGG - Intronic
916831693 1:168498842-168498864 AGGCTTACAAACTTCTAGCCTGG - Intergenic
916957652 1:169856223-169856245 AGGGCTATAACTTTTTAGCTAGG - Intronic
919236274 1:194846936-194846958 AGAGCTATCAACTTTTATCCTGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920020930 1:202956104-202956126 ATGGGAATCAACTTTTAGCATGG + Intronic
922109865 1:222546561-222546583 AGGGGTATAAATTTTTACCAGGG + Intronic
923029517 1:230236292-230236314 AGGGGTATAAACTTTTAGCCTGG - Intronic
924351469 1:243118737-243118759 AGTGGGATTTACTTTTAGCCAGG - Intergenic
1068560399 10:58508946-58508968 CGGGGTATAAACTTCTACCATGG + Intergenic
1083111186 11:60409271-60409293 ATGGGTATAAAATTCTAGACAGG - Intronic
1083451908 11:62751961-62751983 AAGGGTAGGAACTTTCAGCCTGG + Exonic
1089847203 11:121467631-121467653 AGGGGAGGAAACTTTTAGCTGGG + Intronic
1092147029 12:6221832-6221854 AAGGGTTTAAAATATTAGCCAGG + Intronic
1093590642 12:20898060-20898082 AGGATTATATACTTTTATCCAGG - Intronic
1096140979 12:49242284-49242306 AAGGCTGTAAACTTTTGGCCGGG - Intronic
1097112321 12:56669902-56669924 AAGACTATAAACTTTTGGCCGGG - Intronic
1098099232 12:66996126-66996148 AGGGGTAGAGACTTTTAGAGTGG + Intergenic
1099876072 12:88407096-88407118 AGGGAGATAAACTTTAAGCTGGG - Intergenic
1100294252 12:93246110-93246132 AGGGGTAGATAATCTTAGCCAGG - Intergenic
1101887973 12:108685181-108685203 ATAGCTATTAACTTTTAGCCAGG - Intronic
1106963312 13:35027734-35027756 ATGTCTAAAAACTTTTAGCCAGG + Intronic
1107817971 13:44261333-44261355 AGGTGAAGCAACTTTTAGCCCGG + Intergenic
1110186958 13:72686182-72686204 AGGAGTAGAAACTTTTATTCTGG - Intergenic
1111726827 13:92021497-92021519 GTGGGTATAAACTTTCAGTCAGG + Intronic
1111758447 13:92429860-92429882 AGGAATATAAACTTTGAGACAGG + Intronic
1120119105 14:80656531-80656553 AGGGGTATAAACTTTTCAGGTGG - Intronic
1125044290 15:35228835-35228857 AGTGCTAAAAACTTTTACCCTGG - Intronic
1131697814 15:94898727-94898749 AGGGGTAAAAACTTATCGACAGG - Intergenic
1138980609 16:62263346-62263368 AGTAGTATAAACTTCTATCCAGG - Intergenic
1139064581 16:63297182-63297204 AAGGGTACAAAATTTTAGACAGG - Intergenic
1141140503 16:81494067-81494089 AGGGGTGTTACCTTTGAGCCAGG - Intronic
1141865762 16:86748777-86748799 AGGGGTATACACTGTAATCCAGG - Intergenic
1144401293 17:14905051-14905073 AGGCTTATAAAATTTGAGCCAGG + Intergenic
1145410370 17:22655522-22655544 TGGGGTTTCAACATTTAGCCAGG - Intergenic
1150868344 17:68877931-68877953 ATGGATATAAACTGTTGGCCAGG - Intronic
1150913654 17:69414071-69414093 CGGGGTGTCAACATTTAGCCAGG - Intergenic
1151254749 17:72867670-72867692 AGGAGTATAAATCTTGAGCCAGG + Intronic
1152904387 17:82962377-82962399 TGGTGGATAAACTTTTAGCAGGG - Intronic
1153043888 18:838380-838402 AGTGGAATAAACTCTGAGCCGGG - Intergenic
1153358679 18:4168513-4168535 ATGGGTATAAAGTTTTAGTTTGG - Intronic
1156147936 18:34208663-34208685 CGGGGTTTGACCTTTTAGCCAGG - Intronic
1157374225 18:47148893-47148915 AGTTGTATAAATTTATAGCCTGG + Intronic
1159973686 18:74684235-74684257 AGGGGGATAATCTGTTACCCTGG - Intronic
1166428858 19:42705363-42705385 AAGGCTATGAACTTTTAGCATGG + Intronic
931086056 2:58831645-58831667 ATGGGTGTCAGCTTTTAGCCTGG + Intergenic
933783530 2:85819117-85819139 CTGGGTATATACTTTTATCCTGG - Intergenic
933829952 2:86198862-86198884 AGGGGTACAAAAAATTAGCCGGG - Intergenic
933848273 2:86344298-86344320 AGGGGTATGAACTTTTTGGGCGG + Intergenic
934667459 2:96182852-96182874 AAAGCTATAAAATTTTAGCCGGG + Intergenic
935367424 2:102309129-102309151 AGGAGTATAACTTTTTGGCCTGG - Intergenic
935926978 2:108080147-108080169 AGGGGTCTAAGCATTGAGCCTGG + Intergenic
940919023 2:159287062-159287084 AGAGGTAAAAACTTTCAGCAGGG - Intergenic
941193647 2:162419183-162419205 AGAGGTATAAACTCTCAGCTGGG - Intronic
941826974 2:169909531-169909553 AAGGGTACAAAGTTTTAGCTAGG + Intronic
942137237 2:172938439-172938461 AGTGGTTTAAACTGTTTGCCTGG + Intronic
947302300 2:228701748-228701770 AGGGAAAGAAACTTTCAGCCTGG - Intergenic
1169451282 20:5713849-5713871 AGGCATTTAAACTTTTACCCGGG + Intergenic
1178757910 21:35370334-35370356 AGGGATGTAAACTTTTAGAGAGG + Intronic
1180558625 22:16597755-16597777 AGGGGTCTATACTTTAAGCCTGG - Intergenic
949340437 3:3024229-3024251 AGAGGTATATCATTTTAGCCTGG + Intronic
954226643 3:49185978-49186000 AGAGCTATAAAATTATAGCCGGG - Intronic
954875396 3:53799934-53799956 AGGGGCATAAGCTCTTGGCCTGG + Intronic
960791661 3:121438518-121438540 AGGGGTATATAATTTTCTCCTGG - Intronic
960794905 3:121475163-121475185 AAGGGTATAAAGTTTTAGATAGG - Intronic
961709648 3:128818200-128818222 GGAGGTATAAACTTATGGCCAGG - Intergenic
965328402 3:167337324-167337346 AGGGGTTCACAATTTTAGCCAGG - Intronic
979250471 4:118561796-118561818 AGTGGGATTTACTTTTAGCCAGG + Intergenic
981145368 4:141317676-141317698 AGGGGCATTAACTTTGGGCCTGG + Intergenic
982093724 4:151901473-151901495 AAGGGTATAAAGTCTTAGGCTGG - Intergenic
982268713 4:153564893-153564915 AGGGGTAGAAGCTCTGAGCCTGG - Intronic
986312707 5:6566076-6566098 AAGGGTACAAAGTTTTAGGCAGG + Intergenic
989488040 5:42014757-42014779 AGGGATATAAGCTTTGAGACTGG + Intergenic
990089855 5:52029610-52029632 TTGGGTATATACTTTTAACCTGG + Intronic
993325483 5:86529832-86529854 AGAGCTATAAAATTTTAGCTTGG + Intergenic
1004042227 6:11991470-11991492 AGGTGTATAAAATATTGGCCAGG + Intergenic
1012104470 6:95137863-95137885 ATGGGTGTGAAATTTTAGCCAGG - Intergenic
1013583666 6:111560003-111560025 AGAGGCAGAAACTGTTAGCCAGG + Intronic
1015848372 6:137546272-137546294 AATGGTACAAACTTTAAGCCAGG + Intergenic
1016664664 6:146622616-146622638 AGGGGTACAAACCTTTTACCAGG + Intronic
1016889114 6:148988177-148988199 TGGGGTATAAAGTTTGAGGCAGG + Intronic
1024183021 7:46916604-46916626 AGGGGAAAACACTTTTATCCGGG - Intergenic
1025528680 7:61848166-61848188 CGGGGTTTCACCTTTTAGCCGGG + Intergenic
1031813309 7:126399927-126399949 AGGTGTAAAAACTTTGAACCAGG - Intergenic
1034618687 7:152440255-152440277 AGGGGTCTATACTTTAAGCCTGG + Intergenic
1038298452 8:26318978-26319000 ATGGGTATAAAGTTTTAGTTTGG - Intronic
1043012607 8:74900096-74900118 AATGGTATAATCTGTTAGCCTGG - Intergenic
1043636071 8:82383878-82383900 AAGGGTATAAAGTTTTAGTTAGG - Intergenic
1047550668 8:125869213-125869235 AGGGCTATAAACTTAATGCCAGG + Intergenic
1054833990 9:69657165-69657187 ATGGGAATAAAATTTTAGGCAGG - Intronic
1056233288 9:84568557-84568579 AGGGGTTTAGACATTTACCCAGG - Intergenic
1189072164 X:37875148-37875170 AGGGGAAAAGACTTTTAACCAGG + Intronic
1192751486 X:73997047-73997069 AGGGGTTTCACCTTTTGGCCAGG + Intergenic
1194124703 X:90001503-90001525 AAGGGTACAAAGTTTTAGACAGG + Intergenic
1194237947 X:91407975-91407997 AGGCATATCAACTTTTGGCCGGG - Intergenic