ID: 923031428

View in Genome Browser
Species Human (GRCh38)
Location 1:230252049-230252071
Sequence GGGGCATCTGTCCCTCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923031419_923031428 14 Left 923031419 1:230252012-230252034 CCCTGCAAGCAGGAGCACATCTC 0: 1
1: 1
2: 1
3: 7
4: 154
Right 923031428 1:230252049-230252071 GGGGCATCTGTCCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 16
4: 124
923031420_923031428 13 Left 923031420 1:230252013-230252035 CCTGCAAGCAGGAGCACATCTCT 0: 1
1: 0
2: 0
3: 14
4: 168
Right 923031428 1:230252049-230252071 GGGGCATCTGTCCCTCCGTGAGG 0: 1
1: 0
2: 1
3: 16
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923031428 Original CRISPR GGGGCATCTGTCCCTCCGTG AGG Intronic
901024281 1:6270855-6270877 GGGCCATCTGGCCCTCCTTTGGG - Intronic
901514109 1:9733711-9733733 GGGGCATTCTTCCCTCTGTGGGG + Intronic
902117795 1:14136310-14136332 GGGGCATCTGAGGCCCCGTGAGG - Intergenic
902369064 1:15994084-15994106 GGGGCCTCTGTCCCAACCTGTGG + Intergenic
902979384 1:20112342-20112364 GGGGCAGCTGTGCCTGTGTGGGG - Exonic
904963570 1:34354367-34354389 GGGGCATCTTTGCCTCAGTTGGG + Intergenic
905632721 1:39527558-39527580 GGGGCTGCTGTCCCGCAGTGTGG - Intergenic
905665095 1:39758859-39758881 GGGGCTGCTGTCCCGCAGTGTGG + Exonic
907457459 1:54584750-54584772 GGCTCATCTGCACCTCCGTGGGG - Exonic
907462347 1:54612437-54612459 GGGGCATCAGTGCCTCCAGGAGG + Intronic
913112236 1:115666824-115666846 TGGGCATCTGGCTCTCCCTGAGG - Intronic
915327282 1:155086874-155086896 GGGGCATATGTCTCTCTGGGGGG - Exonic
915461353 1:156072396-156072418 GGGGAATCTGTCCCTAGGTGGGG + Exonic
917303768 1:173606232-173606254 GGGGCCTCAGTTCCTCCCTGTGG + Intergenic
917450674 1:175145063-175145085 GGGGCATATGTCCCATCATGAGG + Intronic
919767369 1:201136044-201136066 GGGGCCCCTGCCCCTCCCTGGGG + Intronic
921177674 1:212608351-212608373 CTGGCATCTGTCCCTCCGCTAGG - Intronic
922461421 1:225816929-225816951 GGGGCATATCGCCCTCTGTGTGG - Intronic
923031428 1:230252049-230252071 GGGGCATCTGTCCCTCCGTGAGG + Intronic
1069677782 10:70260756-70260778 TGGGCATCTCTCACTCTGTGGGG - Intronic
1069723562 10:70563999-70564021 TGGGCATCGGTCCTGCCGTGTGG + Intronic
1069746880 10:70720891-70720913 GGGGTATCTGACCATCAGTGTGG - Intronic
1069897386 10:71688117-71688139 GGGGCATGTGTTCCTATGTGAGG + Intronic
1071098738 10:82010858-82010880 GGGGCTTCTGTTCATCAGTGAGG - Intronic
1071601892 10:86962495-86962517 GGGGCCTCTGCTCCTCCTTGAGG + Intronic
1072954720 10:99878325-99878347 GGGGCACGTGTCCCTCCCTCTGG - Intronic
1076070161 10:127482671-127482693 GGGGGCTCTCTCCCTCCCTGTGG + Intergenic
1076567428 10:131408410-131408432 GGAGCATCTCAGCCTCCGTGGGG - Intergenic
1076841473 10:133048018-133048040 GTGGCCTCTGTCGCTCAGTGAGG + Intergenic
1083887930 11:65581711-65581733 TGGGCTTCTGTCCCTTCCTGAGG - Exonic
1084288665 11:68147789-68147811 GGGGCATCTGCCTCTAGGTGAGG - Intergenic
1087338275 11:96870140-96870162 AGGGCAGCTTTCCCTCCATGAGG + Intergenic
1089664903 11:120012294-120012316 GGGGAATTTGCCCCTCGGTGGGG + Intergenic
1089879802 11:121762800-121762822 GGGGCATCTGGGCTTCCCTGAGG - Intergenic
1094493738 12:30976859-30976881 GGGGCATCTGACCCTGGGGGAGG + Intronic
1097185682 12:57195134-57195156 GTGGGGTCTGTCCCTCCCTGGGG - Intronic
1103723538 12:122986999-122987021 GGGGCATCTGCCGCCCAGTGCGG - Intronic
1108083052 13:46757049-46757071 GGGGCTTCAGTCACTCCCTGTGG - Intergenic
1108843184 13:54646689-54646711 GGTTCAGCTGTCCCTCAGTGGGG - Intergenic
1113599338 13:111557694-111557716 GTGGCATCTGTCCATGCCTGAGG + Intergenic
1114162058 14:20179290-20179312 GGAGGATCTGTCCCTCCCTGGGG - Intergenic
1114163704 14:20197506-20197528 GGAGGATCTGCCCCTCCCTGGGG - Exonic
1117546417 14:56797856-56797878 GGGGAGTCTGGCCCTCCGTTGGG - Intergenic
1119480817 14:74956451-74956473 GGTGCATCTGAGCCTCTGTGTGG + Intergenic
1122070079 14:99200524-99200546 TGGGCATCTGTCCCTCAGAGAGG + Intronic
1122407244 14:101507925-101507947 GGGGCATCTGTGCCAGAGTGTGG + Intergenic
1124395290 15:29295299-29295321 GGGGGACCTGGCCCTCCCTGAGG - Intronic
1129105510 15:73304669-73304691 GGGGAATCTGGCCCTCCTGGTGG - Exonic
1130352873 15:83107341-83107363 GGGGCACCTGTCCCTGCGCGGGG + Intergenic
1132564515 16:615346-615368 TGCACATCTGTCTCTCCGTGCGG - Intronic
1132952122 16:2568983-2569005 TGGGCATTTTTCCCTTCGTGTGG + Intronic
1132962228 16:2631187-2631209 TGGGCATTTTTCCCTTCGTGTGG - Intergenic
1134327608 16:13221168-13221190 GGGGCATCTGGCCCTCCCCACGG - Intronic
1137411302 16:48230488-48230510 AGGGCAGCTGTCCCACCGTGGGG - Exonic
1143106830 17:4534337-4534359 GGGGCTTGTGTCCCTGGGTGGGG + Intronic
1143109391 17:4544917-4544939 TGGGCCTCTGTCCCTCAGGGTGG - Exonic
1145963547 17:28901466-28901488 GGGGCAGCAGGCCCTGCGTGGGG - Intronic
1148153036 17:45407414-45407436 TAGTCATCTGTCCCTCTGTGGGG - Intronic
1149493823 17:57104408-57104430 GGAGCATCTGTACCATCGTGGGG - Intronic
1152036142 17:77874338-77874360 GGGGTGGCTGTCCCTCTGTGGGG - Intergenic
1152822671 17:82445230-82445252 GGGGCCTCTGTCTGTCTGTGCGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161766465 19:6211503-6211525 GCTCCATCTGTCCCTCCCTGAGG - Intergenic
1163348800 19:16762254-16762276 GGGACATCTTGCCCTCTGTGCGG - Intronic
1163708176 19:18829166-18829188 GAGGCATCATTCTCTCCGTGGGG + Intergenic
1163993363 19:21020648-21020670 GGGGCCTTTGTCCCTCGCTGTGG + Exonic
1164921975 19:32095099-32095121 GGAGCTGCTGTCCCTCCTTGGGG - Intergenic
1165241864 19:34475557-34475579 GGGACATCTGCCTCTCAGTGTGG - Intergenic
1165794703 19:38512062-38512084 GGGGCGTCTGTCCCTGGGAGAGG - Exonic
1166864159 19:45826048-45826070 GGGGCATCTGGCCCAGCCTGGGG - Intronic
1168124261 19:54275023-54275045 GGGGCATATGTCACTGCCTGGGG + Intronic
926290106 2:11522078-11522100 GGGGCATCTGTCTATCTGTCTGG + Intergenic
926821185 2:16853395-16853417 GGGGCATCTTTCCACCCCTGGGG + Intergenic
927768683 2:25838200-25838222 GGGGAATCTGTCCCACCTTTTGG - Intronic
927886814 2:26723917-26723939 GCTGCATCTGTCCTTCTGTGTGG - Intronic
936287868 2:111194997-111195019 GGAGCAAGTGTCCCTCCCTGCGG + Intergenic
936937620 2:117853420-117853442 GGGACATCTGCTCCTCAGTGGGG + Intergenic
937953854 2:127408318-127408340 GAGGCTCCTGGCCCTCCGTGGGG + Intergenic
938263929 2:129913042-129913064 GGGGTATATGTGTCTCCGTGTGG + Intergenic
939060804 2:137419506-137419528 AGGTCATCTCTCCCTCAGTGTGG + Intronic
941159271 2:162017566-162017588 GGGAGATCTGTCCCTCCCTAGGG - Intronic
944814439 2:203361237-203361259 GGGTCATGTGTCCCTTCCTGAGG + Intronic
945972852 2:216247155-216247177 GGGGCATCTGCCCCACCCTGAGG - Intergenic
1169048729 20:2558842-2558864 GGGGCATCAGTCCCTCACGGGGG - Intronic
1169867577 20:10217922-10217944 GGGGCGTCTGTGCCTCCGTGGGG + Intergenic
1174407195 20:50310152-50310174 GGGGAGCCTGGCCCTCCGTGGGG - Intergenic
1180044011 21:45294496-45294518 GGGGCAGCTTTCCCTCCAAGAGG + Intergenic
1180741603 22:18056991-18057013 GGGGCATCTGACCTTGCCTGCGG + Intergenic
1181001037 22:19987827-19987849 GGGGCTTCTGTGCCTCGATGGGG - Intronic
1181966929 22:26663319-26663341 GAGGCATCTGTCCACCCATGTGG + Intergenic
1183167213 22:36156736-36156758 GGGGCAGCTCTACCTCTGTGTGG + Intronic
1184382606 22:44155307-44155329 GGGGCCTCTGGGCCTCCGTGGGG + Intronic
1184535871 22:45086376-45086398 GGTGGATCCGTCCCTCCCTGTGG + Intergenic
960571356 3:119188128-119188150 AGGGCATCTTTGCCTCCATGTGG - Intronic
961017555 3:123479492-123479514 TGGGCAGCTGGCCCTCCGTGGGG - Intergenic
961538699 3:127586116-127586138 GGGGGATCTGTGCCTGTGTGGGG + Intronic
963908494 3:150794313-150794335 GGGGCAAGTGTCCTTCCCTGTGG - Intergenic
965263255 3:166510432-166510454 GTGGGATCTTTCCATCCGTGTGG - Intergenic
968971994 4:3800695-3800717 GGGACATCGGCCCCTCCCTGTGG - Intergenic
968977371 4:3829038-3829060 GGAGCATCTGTGCCTCCTGGGGG - Intergenic
969402783 4:6967961-6967983 GTGGCATCTCTCCCACCGTAAGG - Intronic
970348816 4:15180520-15180542 GGGGTATTTGTTCCTCCCTGTGG - Intergenic
985532804 5:443638-443660 GGAGCAGGTGTCCCTCCTTGGGG + Intronic
992547752 5:77831616-77831638 TGGGCATCTCTCCCTCCATGCGG + Intronic
997304166 5:132826053-132826075 GTGGCATCTGTCCATGCGCGCGG - Exonic
997878031 5:137566272-137566294 GGGGGATCTGCCCCTCTGTGTGG - Intronic
1005227513 6:23659727-23659749 GAGGCATCTTTCTCTCCCTGAGG + Intergenic
1006414923 6:33897869-33897891 GGTGCATCTGTCCCTTGGTGAGG - Intergenic
1014246744 6:119078320-119078342 GGGGCACCTGTCCCCGCGGGTGG + Exonic
1015924845 6:138298207-138298229 GAGTCATTTGTCCCTCAGTGAGG - Intronic
1016426673 6:143942473-143942495 GAGGCACCTGGCCCTCCATGCGG - Exonic
1018606810 6:165606268-165606290 GGGGCATGTGTCAGTCCGTCAGG + Intronic
1018791885 6:167154874-167154896 AGGGCATCTGTCCCCACCTGTGG + Intronic
1018791896 6:167154911-167154933 AGGGCATCTGTCCCCACCTGTGG + Intronic
1018936061 6:168274729-168274751 GGGGCATGTGTCCCTGGGAGGGG - Intergenic
1019271751 7:153205-153227 GGCGAATATGTCCCTCCCTGAGG + Intergenic
1019777334 7:2919611-2919633 GGAGCATCTTTCCCTCCGCAGGG - Exonic
1019783501 7:2958808-2958830 GGGGCTTCTGTTCCACCCTGGGG + Intronic
1026307279 7:69153011-69153033 GGGGAATTTGTCTCTCCTTGTGG + Intergenic
1029223597 7:99009117-99009139 GGGGCCTCTGTACCTCCGAGGGG - Intronic
1029596302 7:101539117-101539139 GCCCCATCTGTCCCTCCTTGAGG - Intronic
1034470426 7:151251814-151251836 GGCGCATCTCTCCCTGCGCGGGG - Intronic
1034938238 7:155213537-155213559 GGGGCCTCTGGGCCTCCATGAGG - Intergenic
1035176734 7:157057051-157057073 GGGGTGCCTGTCCCTCCCTGCGG + Intergenic
1035176751 7:157057115-157057137 GGGGTACCTGTCCCTCCCTGTGG + Intergenic
1035176771 7:157057195-157057217 GGGGTGCCTGTCCCTCCCTGCGG + Intergenic
1035176789 7:157057259-157057281 GGGGTACCTGTCCCTCCCTGTGG + Intergenic
1035176799 7:157057299-157057321 GGGGTACCTGTCCCTCCCTGTGG + Intergenic
1035176809 7:157057339-157057361 GGGGTACCTGTCCCTCCCTGTGG + Intergenic
1035863157 8:3052428-3052450 GGGGCATCTGCCCATCTTTGTGG - Intronic
1049402969 8:142438792-142438814 TGAGCATCTGTCTCTCCATGTGG + Intergenic
1049403012 8:142439063-142439085 TGAGCATCTGTCTCTCTGTGTGG + Intergenic
1049709130 8:144055870-144055892 GGGACATCTGCATCTCCGTGGGG - Exonic
1056098310 9:83276471-83276493 AGGGCATCTGTGTCTCCCTGTGG + Intronic
1057949749 9:99360291-99360313 GGGGACTCTCTCCCTCCCTGAGG - Intergenic
1060480969 9:124016691-124016713 GGGGCGTGTGTCCCTGTGTGCGG + Intronic
1061539852 9:131272341-131272363 GGGACATCAGGCCCTCCCTGGGG + Intronic
1061647141 9:132013063-132013085 CGGGCATCTGGCCCTCCCAGAGG + Intronic
1062581179 9:137229936-137229958 GGGGCAGCAGTCCTTCCCTGGGG - Intergenic
1186616882 X:11198117-11198139 GGGACATCTGTAACTCTGTGAGG - Intronic
1192849745 X:74942445-74942467 GGGTCATCTGTCCTGCCGTCTGG + Intergenic
1196874950 X:120148388-120148410 GGGGCTTCTGGTCCTCTGTGGGG - Intergenic