ID: 923031647

View in Genome Browser
Species Human (GRCh38)
Location 1:230253736-230253758
Sequence GGTCCCTAGAGTCACCCTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923031642_923031647 14 Left 923031642 1:230253699-230253721 CCTCCTCCTGGTTATTTGAAACT No data
Right 923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG 0: 1
1: 0
2: 0
3: 9
4: 63
923031644_923031647 8 Left 923031644 1:230253705-230253727 CCTGGTTATTTGAAACTCTGTAT 0: 1
1: 0
2: 3
3: 33
4: 281
Right 923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG 0: 1
1: 0
2: 0
3: 9
4: 63
923031643_923031647 11 Left 923031643 1:230253702-230253724 CCTCCTGGTTATTTGAAACTCTG 0: 1
1: 0
2: 2
3: 30
4: 285
Right 923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG 0: 1
1: 0
2: 0
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923031647 Original CRISPR GGTCCCTAGAGTCACCCTAC CGG Intronic
903704375 1:25274409-25274431 GGACCCTAGAGTCAATCTACAGG - Intronic
903722865 1:25418906-25418928 GGACCCTAGAGTCAATCTACAGG + Intronic
904035640 1:27557184-27557206 GGACCCGAGGGTCACCCTGCCGG + Intronic
908580039 1:65505474-65505496 AGTCCATAGAGTCAGCCTCCTGG - Intronic
910393189 1:86765115-86765137 GGTCCTCAAAGTCACCGTACAGG - Intergenic
913063696 1:115230649-115230671 GGTCCCTAGAGCCTCCATACTGG + Intergenic
915038173 1:152946206-152946228 GGTTCCTAAGGTCACCCAACTGG + Intergenic
920987601 1:210905092-210905114 GATCCCTACAGTCACCTTTCAGG - Intronic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
923054315 1:230414183-230414205 GGTGCCTGGAGTCACCCCTCTGG + Intronic
1064613563 10:17128837-17128859 GTTAACTATAGTCACCCTACTGG - Intronic
1067570960 10:47370469-47370491 GGTGCCAAGAGTCACCTTAAGGG + Intronic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1076358780 10:129871794-129871816 AGTCCTCAGAGTCACCCTATTGG + Intronic
1077357048 11:2123264-2123286 AGTCCCTCGAGGCACCCTCCAGG + Intergenic
1077505846 11:2929661-2929683 GGGACCTCGAGTCACCCCACGGG - Intergenic
1086844394 11:91730532-91730554 TGTCCCTAGGGTCTCCCTATAGG + Intergenic
1094421693 12:30277950-30277972 TGTTCCTAGAGTCACTTTACAGG - Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1098156471 12:67604391-67604413 GTTAACTATAGTCACCCTACTGG + Intergenic
1100232196 12:92619744-92619766 GGTCCCTAGACTCACTCCTCAGG + Intergenic
1106425577 13:29625479-29625501 GGTCTCTAGACTCCTCCTACAGG + Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113428237 13:110227948-110227970 GGTCCCTAAATACACCCTCCTGG + Intronic
1113960682 13:114124074-114124096 GGTCCCGAGAGACACCGTGCCGG - Intronic
1117405335 14:55396727-55396749 GCTCCCTAGATGCACCCTAGAGG - Intronic
1122776550 14:104119383-104119405 GGTCCCCAGGGCCAGCCTACAGG - Intergenic
1132770371 16:1558866-1558888 GGTGGCTGGAGTCACCCTTCAGG - Intronic
1132991691 16:2798820-2798842 GGTCCCTAGCGTCACCTTCTTGG + Intergenic
1135663587 16:24317061-24317083 GGTCCCATGAGTGACCCTCCAGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1139597491 16:67966895-67966917 GGTCCCTCCAGTCACCCTGTAGG + Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1141734276 16:85841719-85841741 GTTAACTAGAGTCACCCTACTGG - Intergenic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1159269222 18:66127566-66127588 GTTCCCTAGAGTCTCCATATGGG + Intergenic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1163902957 19:20123239-20123261 GATCCTTAGATTCTCCCTACTGG - Intronic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
935487306 2:103673511-103673533 GTTAACTACAGTCACCCTACTGG - Intergenic
941034226 2:160549958-160549980 GTTCACTATAGTCACCCTACTGG + Intergenic
943662255 2:190571675-190571697 GATCCCTAGAGTCAAACCACAGG + Intergenic
1168880840 20:1204767-1204789 GGTCCCATGAGAAACCCTACTGG - Intronic
1169550556 20:6697460-6697482 GGTCCCAAGGGTCAGCCTCCTGG - Intergenic
1170627635 20:18041771-18041793 GGTCTCTTGAGTGAGCCTACTGG - Intronic
1172975272 20:38901376-38901398 GGTCCATAGAGTCACCAGATTGG - Intronic
1178738277 21:35172113-35172135 GCTCTCTGGAGTCACCCTCCAGG + Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
954333576 3:49903622-49903644 GGACCCTAGAGGATCCCTACCGG + Exonic
954496296 3:50967086-50967108 GTTAACTACAGTCACCCTACTGG + Intronic
963502662 3:146147585-146147607 GGTCCCTGGACTCAACCGACAGG + Intronic
970152366 4:13102954-13102976 GGTCTTTAGATTCACTCTACTGG + Intergenic
975741390 4:77432466-77432488 GGTGCCAAGAGACACCCTAAGGG - Intronic
981729662 4:147884333-147884355 TGTTCCAAGAGTCTCCCTACAGG - Intronic
990993370 5:61707024-61707046 GATTCCTAGAGTCAGCCTCCTGG + Intronic
994331920 5:98516360-98516382 GTTAACTACAGTCACCCTACAGG + Intergenic
994615863 5:102103537-102103559 GGTCCATAGAGTCACTTTGCTGG + Intergenic
994985964 5:106933858-106933880 GGTCCCTATAGACAGCCTAAAGG - Intergenic
1007951400 6:45875760-45875782 GGACTCTAGAGCCACCCTGCTGG - Intergenic
1010029471 6:71258122-71258144 GATCCCTGGAGTCAGCCAACTGG + Intergenic
1010333318 6:74650121-74650143 GTTAACTATAGTCACCCTACTGG + Intergenic
1017294912 6:152782462-152782484 CCTACCTAGAGCCACCCTACTGG + Intergenic
1049488060 8:142876667-142876689 GGTCCCTGGCCTCACCGTACTGG + Exonic
1049492948 8:142914690-142914712 GGTCCCTGGCCTCACCGTACTGG + Exonic
1061167914 9:128934988-128935010 GCTCCCTAGAGCCACCCTAAGGG + Intronic
1189630264 X:42944851-42944873 GATCTGTAGATTCACCCTACTGG - Intergenic
1190320997 X:49179122-49179144 GGACCCTAGAGACACCTCACTGG + Intronic
1194231191 X:91325525-91325547 GTTAACTATAGTCACCCTACTGG - Intergenic
1199705741 X:150423282-150423304 TGTCCCTAGACTTACCCTACAGG - Intronic
1199875840 X:151927301-151927323 TGTGCCTAGAGGCACCCGACAGG + Intergenic
1199902114 X:152186136-152186158 GGTCCCTGGGGTTACACTACAGG - Intronic
1200736352 Y:6800921-6800943 TGTTGCTATAGTCACCCTACTGG + Intergenic