ID: 923034869

View in Genome Browser
Species Human (GRCh38)
Location 1:230278821-230278843
Sequence GCACCTCCATGCTCCCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923034869_923034880 21 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034880 1:230278865-230278887 GGGCTGCTTTCCAACAGCCAGGG 0: 1
1: 0
2: 2
3: 22
4: 207
923034869_923034882 25 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034882 1:230278869-230278891 TGCTTTCCAACAGCCAGGGGAGG No data
923034869_923034871 -4 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034871 1:230278840-230278862 GTGCCCAGACCAAGGCCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 281
923034869_923034881 22 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034881 1:230278866-230278888 GGCTGCTTTCCAACAGCCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 171
923034869_923034874 0 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034874 1:230278844-230278866 CCAGACCAAGGCCTCCAGGCAGG 0: 1
1: 0
2: 3
3: 36
4: 282
923034869_923034875 1 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034875 1:230278845-230278867 CAGACCAAGGCCTCCAGGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 293
923034869_923034879 20 Left 923034869 1:230278821-230278843 CCTAAGTGGGAGCATGGAGGTGC 0: 1
1: 0
2: 1
3: 23
4: 189
Right 923034879 1:230278864-230278886 AGGGCTGCTTTCCAACAGCCAGG 0: 1
1: 1
2: 2
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923034869 Original CRISPR GCACCTCCATGCTCCCACTT AGG (reversed) Intronic
901082802 1:6593022-6593044 GCACCTACTTGTTCCCACCTTGG - Exonic
902571234 1:17348178-17348200 CCACCTACATGCTCCCACTTTGG - Intronic
904384385 1:30131930-30131952 GCAGCTCCCAGCTTCCACTTGGG - Intergenic
905965796 1:42094078-42094100 CCACCTCCATCCTCCAACATTGG + Intergenic
907558546 1:55367183-55367205 AAACCTCTATGCTCCCACTCTGG - Intergenic
907615534 1:55921006-55921028 GCACCTCCATGCCCACCCCTTGG + Intergenic
908809482 1:67965177-67965199 CCACCTCCTTGCACCCACTTAGG + Intergenic
912709352 1:111938784-111938806 GCACATCCCTGCTCCCTCTCTGG - Intronic
914430112 1:147613063-147613085 TCAGCCCCATGCTCCCACCTGGG - Exonic
915323841 1:155070484-155070506 CCACCACCATGCACCCATTTCGG + Intergenic
917876754 1:179293466-179293488 GCAGCTCCATGCTACCACGCAGG + Intergenic
918110038 1:181447486-181447508 GCACCTCTGTACTCCAACTTGGG + Intronic
919356610 1:196532420-196532442 ACATTTCCAAGCTCCCACTTGGG + Intronic
920166464 1:204039709-204039731 GGAGCTCCTTGCTCCCACTTTGG + Intergenic
922452371 1:225747285-225747307 GCACCACTATGCTCCAGCTTAGG - Intergenic
922740707 1:228012808-228012830 GCACCTCCCTGGTACCACTTGGG - Intronic
923034869 1:230278821-230278843 GCACCTCCATGCTCCCACTTAGG - Intronic
923698538 1:236279143-236279165 TTACCTCAATGGTCCCACTTCGG + Intronic
923701175 1:236301734-236301756 TCACCTGCATGCTCCCTCCTGGG + Intergenic
923891181 1:238216518-238216540 GTACCTTCCTGCTCCCAATTAGG - Intergenic
1064771540 10:18728724-18728746 GCATCTTTCTGCTCCCACTTTGG - Intergenic
1065871314 10:29958775-29958797 GCACCTCTGTGCTCTCACTGGGG + Intergenic
1067526317 10:47040869-47040891 GAACCTGCATGCTGTCACTTAGG + Intergenic
1068750301 10:60584572-60584594 GCACCACCATACTCCAACCTGGG + Intronic
1073192335 10:101660576-101660598 TTAACTCCATGCTTCCACTTTGG + Intronic
1074856919 10:117480569-117480591 GCATCTCCATCCTCCCTCCTAGG + Intergenic
1075178405 10:120187196-120187218 CCACCTCCATGCTTACACTCAGG - Intergenic
1075178414 10:120187236-120187258 CCACCTCCATGCTCACACTCAGG - Intergenic
1075178423 10:120187276-120187298 CTACCTCCATGCTCACACTCAGG - Intergenic
1075178430 10:120187316-120187338 CCACTTCCATGCTCACACTCAGG - Intergenic
1075178438 10:120187356-120187378 CCACCTCCATGCTCACACTCAGG - Intergenic
1075178446 10:120187398-120187420 CCACTTCCATGCTCACACTCAGG - Intergenic
1075178454 10:120187438-120187460 CCACCTCCATGCTCACACTCAGG - Intergenic
1075810069 10:125218801-125218823 GGTCCCCCAGGCTCCCACTTGGG - Intergenic
1076789631 10:132769871-132769893 GCAGCTCCATGCTACCACTGGGG - Intronic
1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG + Intergenic
1078601230 11:12733054-12733076 GCACCTCCATTGACCCACATGGG + Intronic
1079246814 11:18758394-18758416 GCACCTCAGTGCTCCTACCTTGG - Intronic
1080381741 11:31778942-31778964 GAACTCCCAGGCTCCCACTTCGG + Intronic
1081386174 11:42476225-42476247 TCACCTCCCTCCTCCCACTGTGG + Intergenic
1081889530 11:46529292-46529314 GAACCTCCATTTTCCCCCTTTGG + Intronic
1083289538 11:61682066-61682088 GCATCTCCAAGCACCCACCTTGG - Intronic
1084214651 11:67640761-67640783 GCCCCTCCATGCCCCCTCTTAGG - Intergenic
1084450304 11:69232874-69232896 GCCCCTCCATCCTCCCACCTGGG - Intergenic
1085643123 11:78205841-78205863 GGACCTCCATGTTCCCAATGAGG + Exonic
1088858755 11:113780267-113780289 GCACCTCCAAACTCCCACCGAGG - Exonic
1089642818 11:119858987-119859009 CCCCATCCATCCTCCCACTTGGG + Intergenic
1089680478 11:120116507-120116529 GCACCGCCAGGCTGCCAGTTGGG + Intronic
1093450419 12:19307111-19307133 GCAGCTACATGCTTCAACTTGGG - Intronic
1094545528 12:31401191-31401213 GCATCACCATGCTCTAACTTAGG + Intronic
1096526071 12:52211135-52211157 CCACCTCCATGCTCCCTCTCTGG - Intergenic
1099873834 12:88380989-88381011 GCACCACCATACTCCAGCTTGGG - Intergenic
1100744311 12:97628718-97628740 GCACTTCCAGCTTCCCACTTGGG + Intergenic
1104257358 12:127151422-127151444 GCACCTAGATGGTCCCATTTGGG + Intergenic
1113693688 13:112329603-112329625 CCAGCTCCATGCTCCCACTCAGG + Intergenic
1113746608 13:112749752-112749774 GAATCTCCATCCTCCCACGTGGG + Intronic
1113823405 13:113231767-113231789 GCACCTTCCTGCTCCAACTGTGG + Intronic
1114180533 14:20363506-20363528 GCACCACCACGCTCCAGCTTGGG + Intergenic
1114668707 14:24397881-24397903 GCCCCTCCCTGCCCCCAATTGGG + Intergenic
1115479351 14:33846086-33846108 GCACCTCCATTCACCCAAGTAGG + Intergenic
1119137898 14:72237734-72237756 TCACCTGCATGCTCCCTCTCAGG - Intronic
1119770276 14:77216334-77216356 GCACCCCGAGGCTCCCACCTTGG + Intronic
1121359231 14:93241184-93241206 GCACCACTGTGCTCCCACCTGGG - Exonic
1121685422 14:95831886-95831908 GCACCTCCATACTTCCATCTGGG + Intergenic
1122924821 14:104894730-104894752 GCAGGTCCAGGCTCCCACTGGGG - Exonic
1123146805 14:106141238-106141260 CCTCCTCCCTGCTCCCACTCAGG + Intergenic
1126787673 15:52191465-52191487 GCACTTCCATGCTCCCTGCTGGG + Intergenic
1127844938 15:62861728-62861750 GCACCTCCATGCTCTTACCAGGG + Intergenic
1129659568 15:77545505-77545527 CCTCCTCCCTGCTCCCTCTTGGG + Intergenic
1129757290 15:78106053-78106075 GCATCTCCATGCACACTCTTGGG + Intronic
1133657794 16:7883183-7883205 CAGCCTCCATGCTCCGACTTTGG + Intergenic
1134534667 16:15016274-15016296 GGACATCCAGGCTCTCACTTTGG + Intronic
1136692261 16:32040310-32040332 CCTCCTCCCTGCTCCCACTCAGG - Intergenic
1136792757 16:32983539-32983561 CCTCCTCCCTGCTCCCACTCAGG - Intergenic
1136877098 16:33870515-33870537 CCTCCTCCCTGCTCCCACTCAGG + Intergenic
1137821354 16:51449019-51449041 CCACCCCCATGCTCCAACTCAGG + Intergenic
1139541557 16:67621485-67621507 GCATCTTCATGGTACCACTTTGG - Exonic
1139861379 16:70024503-70024525 GGACATCCAGGCTCTCACTTTGG - Intergenic
1140666020 16:77228334-77228356 GCACCACCTGGATCCCACTTTGG + Intergenic
1203095014 16_KI270728v1_random:1245227-1245249 CCTCCTCCCTGCTCCCACTCAGG - Intergenic
1142966252 17:3583614-3583636 GCACCTGCAGGCTGCCACTTTGG - Intronic
1143112290 17:4559438-4559460 GCAGCCACATGCTCCCACCTAGG - Exonic
1146218350 17:30997049-30997071 GCACCTCCATGTTCTCACTGTGG - Intronic
1146475270 17:33157663-33157685 CCACCTCCCTGCTCCCACCTTGG + Intronic
1147807442 17:43141843-43141865 GCACCTCCAGGTTCCTATTTTGG - Intergenic
1150218948 17:63485062-63485084 TCCCCTGCATGGTCCCACTTGGG - Exonic
1151405924 17:73886147-73886169 GCTCCTCCATGCTCCATCTCAGG + Intergenic
1152051230 17:77980094-77980116 GCATCTCCATGCTTCCAGCTGGG - Intergenic
1152671370 17:81609355-81609377 GCACCACCATACTCCAACCTGGG - Intronic
1152758466 17:82096946-82096968 CCACCTCCATGCCCCGGCTTTGG - Intronic
1154974642 18:21445034-21445056 GCACCTGCATACACCCACTTTGG - Intronic
1156383048 18:36581416-36581438 TCACCTCCTTGCTGCCTCTTAGG + Intronic
1156480353 18:37432347-37432369 CCACCTCCAAGCTCCCCCTCTGG - Intronic
1156760618 18:40584109-40584131 GCACCTCCCTGCCCCTACTTCGG + Intergenic
1161709962 19:5842134-5842156 GCCCCTCCACCCTCCCACCTGGG + Intergenic
1161713722 19:5864023-5864045 GCCCCTCCACCCTCCCACCTGGG + Intergenic
1162490450 19:10988062-10988084 TCACCTCCCTGCTCCCACCCTGG + Intronic
1164749706 19:30643681-30643703 CCACCTCCATGCTTCCACACAGG - Intronic
1165326106 19:35115459-35115481 GCTCCCCCATGGTCCCAGTTGGG - Intergenic
1165371274 19:35407900-35407922 GCACCTCCAGGTCCCCACTTGGG - Intergenic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167129024 19:47572615-47572637 CCTCCTCCATAGTCCCACTTTGG - Intergenic
925761840 2:7192375-7192397 GCTCCTCCCTTATCCCACTTTGG + Intergenic
928298714 2:30107293-30107315 GCACCACCATGCTCCAGCCTGGG + Intergenic
929208031 2:39320719-39320741 GCAGCTCCATACTCACACTAAGG + Intronic
930013937 2:46958027-46958049 GAACCTCCATGCTCTGACTCTGG + Intronic
931214882 2:60232340-60232362 GCACCTTCAAGCTCCCATCTGGG - Intergenic
935038678 2:99404379-99404401 TCACCCCCCTGCTCCAACTTAGG - Intronic
936427761 2:112434872-112434894 TGACCTCCAAGCTCCCACTGGGG + Intergenic
938536176 2:132251422-132251444 TCACCACCAGGCTCCAACTTGGG + Intronic
938576143 2:132606468-132606490 CCATCTTCATGCTCCCCCTTGGG - Intronic
938780747 2:134582615-134582637 GCACCACCATGCACCAGCTTGGG - Intronic
938968075 2:136406283-136406305 GCACCTTCATACTCGCCCTTTGG - Intergenic
939616204 2:144364463-144364485 CCACCACCATGCTCCAACCTGGG - Intergenic
942564650 2:177254478-177254500 GCACCACCGTGCTTCCACTGGGG + Intronic
942768775 2:179489145-179489167 TCATCTCCATTCTGCCACTTCGG - Intronic
943383082 2:187174157-187174179 TCACCTCTATGCTCCAACTGAGG - Intergenic
945517288 2:210778277-210778299 GCACCTCCATTCTCCTATCTGGG + Intergenic
946394973 2:219439055-219439077 GCTCCTCTCTGCTCCCACTCTGG - Intronic
947726016 2:232401259-232401281 GCACCACCACGCTCCAACCTGGG - Intergenic
948687060 2:239676235-239676257 GCCCCCTCATGCTCCCACTGAGG - Intergenic
948992336 2:241561447-241561469 GCACTGCCACGCTCCCACCTGGG - Intronic
948992354 2:241561498-241561520 GCACTGCCACGCTCCCACCTGGG - Intronic
948992370 2:241561549-241561571 GCACTGCCACGCTCCCACCTGGG - Intronic
948992388 2:241561600-241561622 GCACTGCCACGCTCCCACCTGGG - Intronic
948992404 2:241561651-241561673 GCACTGCCACGCTCCCACCTGGG - Intronic
948992422 2:241561702-241561724 GCACTGCCACGCTCCCACCTGGG - Intronic
948992438 2:241561753-241561775 GCACTGCCACGCTCCCACCTGGG - Intronic
1169718651 20:8648042-8648064 GCATTTCCACACTCCCACTTAGG - Intronic
1171503007 20:25608865-25608887 GCACCACTGTACTCCCACTTGGG + Intergenic
1171865075 20:30483244-30483266 TCACCACCAGGCTCCAACTTGGG + Intergenic
1172359420 20:34302041-34302063 GCACCACCACGCTCCAACCTGGG - Intronic
1174093595 20:48069512-48069534 GCTCATCAATGCTTCCACTTTGG + Intergenic
1176374483 21:6080339-6080361 TGACCTCCAAGCTCCCACTGGGG - Intergenic
1176873272 21:14101206-14101228 GCACCACCATGCTCCAACCTGGG - Intergenic
1179095959 21:38314570-38314592 TCATCTGCATGCTCCCACTATGG + Intergenic
1179748992 21:43457906-43457928 TGACCTCCAAGCTCCCACTGGGG + Intergenic
1181784166 22:25214293-25214315 GCACCACCATGCTCCAGCCTGGG + Intergenic
1182134042 22:27883939-27883961 GCAGCCTCATGCTCCCACTTGGG + Intronic
1185372807 22:50468800-50468822 CCACCGCCAGGCCCCCACTTAGG + Intronic
950894782 3:16438903-16438925 TAACCTCCATGCTCCCAAATCGG + Intronic
953181280 3:40597373-40597395 GCACCACCCCACTCCCACTTTGG - Intergenic
954354149 3:50070880-50070902 GAACCTCCATTCTCACACATAGG + Intronic
954629328 3:52039668-52039690 CCACTTCAATGCTCCCTCTTGGG + Intergenic
954847942 3:53576142-53576164 GCAGCAGCATGCTCCCACTGTGG - Intronic
959312211 3:104753547-104753569 GCACCTCACTGCTATCACTTTGG + Intergenic
960542602 3:118878350-118878372 GCACCCCTATCCTCCCACCTGGG - Intergenic
961108968 3:124267657-124267679 GCACCTCCTTCCTTCCTCTTAGG + Intronic
962129457 3:132657903-132657925 GCACCACCATGCTCCAGCCTAGG - Intronic
962321224 3:134392234-134392256 ACACCTCCGTGCTTCCATTTGGG + Intergenic
964693136 3:159476010-159476032 GTACCTCGAAGCTGCCACTTGGG + Intronic
966941824 3:184752715-184752737 TCACCTCCAGGCCCCCACCTGGG - Intergenic
969197743 4:5576632-5576654 TCACCTCCATGCCTCCACATAGG + Intronic
971379751 4:26085861-26085883 GCAAGTCCATGCTCCCTCTGCGG - Intergenic
971796784 4:31238717-31238739 CCACCTCCATGCTAGCATTTAGG + Intergenic
972419884 4:38877338-38877360 GCAACTAGATGCTCCCACCTGGG + Intronic
976125041 4:81824993-81825015 GAAGCTCCATTCTCCCACTTGGG - Intronic
978407938 4:108399292-108399314 TCAGCTCCATTCTCCCACCTTGG - Intergenic
978595670 4:110374520-110374542 GCACCTAGCTGCTCCCACTCTGG - Intronic
978867098 4:113526247-113526269 GCACATACATGCTCCAACTGGGG + Intronic
982235737 4:153249588-153249610 CCACCTCCCTGCTCCCGCCTCGG + Intronic
986199891 5:5570847-5570869 GCCCCTCCAAGCACCCACTGAGG - Intergenic
986428481 5:7657919-7657941 GCAGCTCCCAGCTCCCACTGAGG + Intronic
987195489 5:15521805-15521827 GCAGCTCCATCATCCCCCTTAGG - Intronic
992672707 5:79075855-79075877 GTACCTGCATGCTCCCCCTAGGG - Intronic
994182722 5:96785095-96785117 CCACCTGCATGCTTCCTCTTAGG + Intronic
998007517 5:138666715-138666737 GTCCCTCCCTCCTCCCACTTTGG + Intronic
998017822 5:138746530-138746552 GCAACTCCATCCTCTCATTTTGG - Intronic
998856004 5:146395571-146395593 TCACCTCCCTGCCCCCATTTAGG - Intergenic
1000408711 5:160916054-160916076 CCTCCTCCATGTTCCCACTGAGG + Intergenic
1000960901 5:167599883-167599905 ACACCTGCAGTCTCCCACTTTGG + Intronic
1001669654 5:173463231-173463253 GCCCTTCCTTGCTCCCTCTTAGG - Intergenic
1007592750 6:43032816-43032838 GCAGCTCTATGCCCCCAGTTAGG + Intronic
1012836094 6:104270583-104270605 GCACCTCTGTGCTCCCTTTTGGG + Intergenic
1014783124 6:125587492-125587514 GCACCACCATGCTCCAGCCTGGG + Intergenic
1016458012 6:144251289-144251311 GCTGCTCCATGCTCCCTCTGAGG + Intergenic
1016469537 6:144360755-144360777 GCATCTCCAAGTTCCCAGTTGGG + Intronic
1016720692 6:147293853-147293875 GCACCACCATGCTTTCACTGAGG - Intronic
1018937722 6:168284504-168284526 CCTCCCCCATGCTCCCACTCTGG + Intergenic
1019194615 6:170273833-170273855 CCAGCTGCATGCTACCACTTTGG + Intergenic
1020081315 7:5287373-5287395 GCACCACCATACTCCAACCTGGG + Intronic
1022009114 7:26293080-26293102 TCACCTCCATTCTCTCACTGAGG - Intronic
1022762091 7:33365808-33365830 ACACATCCATGCTCCCATCTCGG - Intronic
1025674347 7:63632136-63632158 GCACCACCATACTCCAACCTGGG + Intergenic
1026944771 7:74308545-74308567 GCACCACCATGCTCCAGCCTGGG - Intronic
1027808812 7:82865802-82865824 ACACCTCCCTGTTCCCACCTTGG + Intronic
1030939534 7:115629201-115629223 GCAACTAGATGGTCCCACTTGGG - Intergenic
1036425925 8:8645376-8645398 GCACCTCCAGGCTCCCACAGGGG + Intergenic
1036517122 8:9454703-9454725 GGAGCTGCATCCTCCCACTTTGG + Intergenic
1037774061 8:21821170-21821192 GCACCTGACTTCTCCCACTTGGG - Intergenic
1038334326 8:26634305-26634327 GCACCACCATACTCCAACCTGGG - Intronic
1043523730 8:81073944-81073966 GCCCCTCCATGTGCCCACCTTGG + Intronic
1046646738 8:116793791-116793813 GCACAACCATTCTCCCACCTTGG + Intronic
1049572603 8:143376285-143376307 GCACCTGCATGTTCCGACTCTGG - Intronic
1050175453 9:2865321-2865343 GCCTCTCCATCCTCCCACTCTGG - Intergenic
1052380626 9:27767154-27767176 GCACCTCCCTTCACCCACCTGGG + Intergenic
1053239721 9:36486752-36486774 GCACCACCAAGCTCCCAAGTCGG + Intronic
1054685520 9:68273030-68273052 GCACCACCACACTCCAACTTGGG - Intronic
1057186865 9:93061984-93062006 GCCCCTCCATCCTCCCTCCTGGG - Intronic
1057307737 9:93921820-93921842 GCCCCTCCATCCTCCCACGTGGG - Intergenic
1058886282 9:109323544-109323566 GCACCTCCGTGCTCCAGCCTGGG - Intergenic
1061300567 9:129702588-129702610 GCAGCTCGTTGCTCCCACGTTGG + Intronic
1061337396 9:129949528-129949550 CCACATCCATGCTCAGACTTCGG - Intronic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1186883052 X:13885613-13885635 GCACCTCCCTGCCATCACTTGGG - Intronic
1189057952 X:37718960-37718982 GTATCTCCATGCTTCCACATAGG + Intronic
1190578034 X:51860963-51860985 GCAGCTCCATTCTCCCAGGTAGG - Intronic
1191189267 X:57649271-57649293 TAACCTTCATGTTCCCACTTGGG - Intergenic
1192208799 X:69113814-69113836 CCACCTCCATGCCTTCACTTGGG + Intergenic
1193278528 X:79620683-79620705 GCAACTACATGGTCCCACCTGGG - Intergenic
1197923406 X:131620419-131620441 GCCCCTCAATTCTCCCATTTAGG + Intergenic
1198231980 X:134698911-134698933 GCATCACCATCCACCCACTTAGG + Intronic
1201561588 Y:15322847-15322869 GCATCTCCTTGATGCCACTTTGG - Intergenic
1201736914 Y:17277312-17277334 GCACATTCATGCTAACACTTGGG + Intergenic