ID: 923035097

View in Genome Browser
Species Human (GRCh38)
Location 1:230280155-230280177
Sequence CGGGCTCTGGCCCCTTCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 360}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035097_923035111 24 Left 923035097 1:230280155-230280177 CCGGGAGAAGGGGCCAGAGCCCG 0: 1
1: 0
2: 2
3: 37
4: 360
Right 923035111 1:230280202-230280224 AGGAGGTGGCCTTTGTCCCCTGG 0: 1
1: 0
2: 1
3: 23
4: 269
923035097_923035107 4 Left 923035097 1:230280155-230280177 CCGGGAGAAGGGGCCAGAGCCCG 0: 1
1: 0
2: 2
3: 37
4: 360
Right 923035107 1:230280182-230280204 GGCCAGTTTCTCACAGAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 195
923035097_923035105 0 Left 923035097 1:230280155-230280177 CCGGGAGAAGGGGCCAGAGCCCG 0: 1
1: 0
2: 2
3: 37
4: 360
Right 923035105 1:230280178-230280200 GTGGGGCCAGTTTCTCACAGAGG 0: 1
1: 0
2: 6
3: 10
4: 160
923035097_923035110 10 Left 923035097 1:230280155-230280177 CCGGGAGAAGGGGCCAGAGCCCG 0: 1
1: 0
2: 2
3: 37
4: 360
Right 923035110 1:230280188-230280210 TTTCTCACAGAGGGAGGAGGTGG 0: 1
1: 0
2: 3
3: 61
4: 553
923035097_923035106 1 Left 923035097 1:230280155-230280177 CCGGGAGAAGGGGCCAGAGCCCG 0: 1
1: 0
2: 2
3: 37
4: 360
Right 923035106 1:230280179-230280201 TGGGGCCAGTTTCTCACAGAGGG 0: 1
1: 1
2: 2
3: 36
4: 290
923035097_923035109 7 Left 923035097 1:230280155-230280177 CCGGGAGAAGGGGCCAGAGCCCG 0: 1
1: 0
2: 2
3: 37
4: 360
Right 923035109 1:230280185-230280207 CAGTTTCTCACAGAGGGAGGAGG 0: 1
1: 1
2: 2
3: 24
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035097 Original CRISPR CGGGCTCTGGCCCCTTCTCC CGG (reversed) Exonic
900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG + Intronic
900447668 1:2689517-2689539 GGGGCTCTGGGCACTGCTCCAGG - Intronic
900450520 1:2747297-2747319 GGGGCTCTGGGCACTGCTCCAGG - Intronic
900888146 1:5429909-5429931 CCAGCTCTGGCATCTTCTCCTGG + Intergenic
900928413 1:5720279-5720301 CCAGCTGTGGCCCCATCTCCCGG - Intergenic
901399432 1:9005914-9005936 GGGGCCCGGGCCCCTTCTCCAGG + Intronic
902373023 1:16017263-16017285 GGGGTTCTGGCTCCTTCTCTTGG + Intronic
902586068 1:17439124-17439146 CGGGCTCTTCCCCCGTCGCCGGG - Intronic
903232146 1:21928334-21928356 CGTGCTCTGGCCCCTGCACTTGG - Intronic
903833620 1:26189221-26189243 CGGGCTCTGCCCACTTCCCTGGG + Intronic
904171095 1:28592619-28592641 CGGGCTCGGGCTCCGGCTCCGGG - Intronic
905336285 1:37246838-37246860 CTGGCTCCCGCCCCTGCTCCGGG - Intergenic
905509332 1:38506112-38506134 TGGGCTGTGTCCCCATCTCCTGG + Intergenic
905584160 1:39104682-39104704 CAGGCTCTGGCTCCTTGGCCTGG + Intronic
906105187 1:43287321-43287343 CAGGCTCTGCTCCCTTCTCCTGG + Intergenic
906451674 1:45954645-45954667 CAGGCTCTGGCCATTTCCCCAGG - Intronic
906477112 1:46176582-46176604 TGGGCCCTGGCCCCTCCTCATGG + Intronic
908865891 1:68548197-68548219 CGGCCTCTTGCCCCTCCTGCAGG + Intergenic
911208557 1:95117314-95117336 CGGGCTCCGGCTCCCGCTCCGGG - Intergenic
911657976 1:100466294-100466316 TGGGCTCTGGCTTCTGCTCCAGG + Intronic
912419780 1:109535224-109535246 TGGGCTCTGTCCCCTTCTCTGGG - Intergenic
912490082 1:110057967-110057989 AGGGCTCTGGCATCTTCTCTGGG + Intronic
917406390 1:174711726-174711748 CTGGCACTGCCCCCTACTCCGGG + Intronic
918385673 1:184005121-184005143 CGTGCTCTGGGTCCTTGTCCTGG - Intronic
919047362 1:192470275-192470297 GGAGCTCAGGCCCCTACTCCTGG + Intergenic
919990342 1:202704879-202704901 AGGGCTCTGGCACCTCCTTCAGG - Intronic
920031206 1:203038473-203038495 CTGGCGCATGCCCCTTCTCCAGG - Intronic
920257940 1:204668964-204668986 CAGGCTCTGGCCACTACACCTGG + Intronic
920525849 1:206665664-206665686 TGTGTTCTGGCTCCTTCTCCAGG + Intronic
920645497 1:207800636-207800658 CGGGCTGTGGCCCCTTGATCAGG - Intergenic
920682798 1:208085411-208085433 CTTTCTCTGTCCCCTTCTCCTGG + Intronic
920878406 1:209858688-209858710 GGAGCTCCGGCCCCTGCTCCAGG - Intergenic
921738565 1:218656835-218656857 CAGGCTCTGTGCCTTTCTCCTGG + Intergenic
922460014 1:225808740-225808762 CTGCCTCTGGCCACTTCACCAGG - Intergenic
922800493 1:228362669-228362691 CTGGCCCTGGCCCCTGCCCCAGG + Exonic
923035097 1:230280155-230280177 CGGGCTCTGGCCCCTTCTCCCGG - Exonic
923146125 1:231199502-231199524 CCAGCTCTGTCCCCTTCTTCAGG + Intronic
923513538 1:234674382-234674404 CTGCTCCTGGCCCCTTCTCCCGG - Intergenic
1062982583 10:1737443-1737465 CGGGCTCTGCCTCCTGCTCTGGG + Exonic
1064003598 10:11683201-11683223 CCGGCTCTGGCCCCGCTTCCAGG + Intergenic
1066654857 10:37687812-37687834 TGGGAGCTAGCCCCTTCTCCAGG + Intergenic
1067031933 10:42884174-42884196 CGGCCCCAGGCCCCTTCCCCAGG - Intergenic
1067837993 10:49653335-49653357 CAGGAGCTGGCCCCATCTCCAGG - Intronic
1070428670 10:76315301-76315323 CGGGCTCCCGCCCCTTCAACTGG - Intronic
1071306719 10:84305670-84305692 CGGGCTCTTCCCTCTTCTCTTGG + Intergenic
1073290676 10:102411819-102411841 CCCTCTCTTGCCCCTTCTCCAGG - Exonic
1073542251 10:104323805-104323827 CCAGCTCAGGGCCCTTCTCCAGG + Intronic
1076347328 10:129788393-129788415 CGGGCTCTGCCCACTGCTCCCGG - Intergenic
1076350439 10:129811541-129811563 TGGACCCTGCCCCCTTCTCCCGG + Intergenic
1076773662 10:132680974-132680996 CGAGCTCCGCCCCCTGCTCCAGG + Intronic
1076796486 10:132800984-132801006 CGAGCTCCGCCCCCTGCTCCAGG - Intergenic
1077014271 11:392974-392996 CTGGCTCTGGGCTCTCCTCCAGG - Intronic
1077070271 11:667177-667199 CCGGCACTGGCCACTACTCCCGG - Intronic
1077201359 11:1309190-1309212 CGGGCGCAGGCCCCCTCCCCCGG + Intronic
1077892316 11:6428185-6428207 TGCGCTATGGCCCCTTTTCCTGG - Intergenic
1078210397 11:9265341-9265363 CGCGCTCTCCGCCCTTCTCCAGG - Exonic
1078710059 11:13782822-13782844 AGGGGTCTGGCCCTTTCTCGGGG - Intergenic
1080561224 11:33464963-33464985 TGAGCTCTGGCCCTTTGTCCAGG + Intergenic
1081866104 11:46361638-46361660 CGGGCTCTGGATCCAGCTCCGGG - Exonic
1081908451 11:46684063-46684085 CAAGCTCTGGCCACTTCACCAGG - Intronic
1083227699 11:61295103-61295125 CCGGCCCTCGCCCCTCCTCCTGG + Exonic
1083587145 11:63868621-63868643 CTGGCTCTGGTCCCCACTCCAGG - Intronic
1083793678 11:65002156-65002178 CGGGCTCTGGTCACCTCCCCAGG + Intergenic
1084184581 11:67464856-67464878 CGGGCTCTGGTCCCTCCCGCAGG - Exonic
1084501318 11:69537265-69537287 CCAGTTCTGGCTCCTTCTCCAGG - Intergenic
1084891650 11:72239806-72239828 CCGGCCCCGGGCCCTTCTCCGGG - Exonic
1085034260 11:73290790-73290812 CGGGCCCTGCCCCCTCCTCTAGG + Intronic
1085299890 11:75451609-75451631 GGCACTCAGGCCCCTTCTCCCGG + Intronic
1085415912 11:76318854-76318876 GGGGCTTGGGCCCCATCTCCAGG - Intergenic
1085444397 11:76590745-76590767 CAGGCCCAGGCCCCCTCTCCAGG - Intergenic
1086064668 11:82732946-82732968 CGGCCTCCGCGCCCTTCTCCAGG + Exonic
1088653267 11:111976923-111976945 GGGGCTCTGGCCGCTCCTCGGGG - Intronic
1089045988 11:115503092-115503114 CGTCCTCTGGCCCCTGCTGCAGG - Intronic
1090084736 11:123641130-123641152 GGGGCCCTGGCGCCCTCTCCTGG - Intronic
1090349338 11:126097563-126097585 CGTGCACTGGCCTGTTCTCCTGG + Intergenic
1090385888 11:126357301-126357323 GGGGATCTGGCCCCAACTCCTGG - Intronic
1090424433 11:126597227-126597249 CGGGCTCTGGCCCAGGCTCCAGG - Intronic
1091301967 11:134513744-134513766 CAGGCTCTGACCCCTTGGCCAGG - Intergenic
1091301989 11:134513833-134513855 CAGGCTCTGACCCCTTGGCCAGG - Intergenic
1091339758 11:134801175-134801197 GGGACGCTGGCCCCTTATCCAGG + Intergenic
1091634354 12:2186006-2186028 CGCTCTCTGGCTCCTTTTCCAGG + Intronic
1091748878 12:3010458-3010480 CGGGCTCAGGCCTCCTCTCCAGG + Intronic
1091818465 12:3456719-3456741 CGGGCGTTGGCCCCTTCTCACGG - Intronic
1092854714 12:12662243-12662265 CTGGCTGTGGCCACTTCCCCGGG + Exonic
1093435458 12:19130163-19130185 CGGGCTCTGCCGCCTCCTCCAGG - Intronic
1096425699 12:51500827-51500849 CAGGCTCTCGCCCCTGCGCCTGG + Intronic
1097166561 12:57089308-57089330 CGGGCGCTGTCCCCTCCGCCCGG - Exonic
1097166862 12:57090611-57090633 GGGGCTGTGGCCCCTTCACAGGG + Intronic
1099014085 12:77324771-77324793 CGGGGTCTGGGCCCTTGCCCAGG - Intergenic
1099443868 12:82729045-82729067 CGAGCGCTGCCCCCTGCTCCAGG + Intronic
1099572052 12:84334918-84334940 GGGGCTCTTGCCCCTTCGCTCGG + Intergenic
1101285703 12:103309961-103309983 AGGTCTCTGGCCCCTTATACTGG - Intronic
1101609695 12:106279313-106279335 CGGCCCCTGGCCCCATCTCATGG + Intronic
1102469530 12:113151966-113151988 CCAGCTCTTGCCTCTTCTCCAGG - Exonic
1102865937 12:116374008-116374030 CTGGCTCAGTCCGCTTCTCCTGG - Intergenic
1103027037 12:117582213-117582235 GGGGCTCTGGCCCCTGCCCTGGG - Intronic
1103321837 12:120096697-120096719 CAGGGTCTTGCCCCTTCTCCGGG - Exonic
1104133354 12:125915660-125915682 CGTGATCTGACTCCTTCTCCAGG + Intergenic
1104319937 12:127741565-127741587 CTGGATCTGGACCCTTTTCCAGG - Intergenic
1104633546 12:130424403-130424425 CGGCCTCGGGCCCCTCCTGCAGG + Intronic
1104648186 12:130511872-130511894 TGGGCCCTGGCTCCTTCTCCAGG + Intronic
1104676444 12:130715032-130715054 CGGGCTCTGGGCCCTGCGGCAGG - Intronic
1104951966 12:132445209-132445231 AGGGCTCCGCCCCCATCTCCAGG + Intergenic
1104982895 12:132582046-132582068 CGGCCTCTGCCCCCAGCTCCCGG + Exonic
1105507542 13:21023341-21023363 CAGGCGCTCGCCCCCTCTCCAGG + Intronic
1108091331 13:46853180-46853202 CAGGCTGTAACCCCTTCTCCTGG - Intronic
1110922349 13:81103626-81103648 CGGGTTCTGTCACCTGCTCCAGG + Intergenic
1113394226 13:109931046-109931068 TGGGCTCTGGGCCCTCTTCCTGG - Intergenic
1113737663 13:112689998-112690020 CTGGCTCCTGCCCCTGCTCCGGG - Intergenic
1113778543 13:112962780-112962802 CCGGCTCTGCCCCTTTCTCCAGG + Intronic
1114788193 14:25625225-25625247 GGGGCTCTTCCCCCTTCTCTTGG - Intergenic
1115284308 14:31700871-31700893 CGGGTGCTGCCCCCTGCTCCAGG + Intronic
1115970877 14:38943526-38943548 GGAGCTCTGCCTCCTTCTCCTGG + Intergenic
1116971859 14:51074716-51074738 TGAGCTCTGCCCCCTTATCCTGG - Intronic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1118717249 14:68569201-68569223 AGGGCTCTGGCCCATTCCTCCGG - Intronic
1118723240 14:68608905-68608927 CATGCTGTGGCCCCTCCTCCGGG + Intronic
1119236926 14:73027241-73027263 CGCGCTCTCGCCCCTCATCCCGG + Intergenic
1120889228 14:89476939-89476961 GGTTCTCTTGCCCCTTCTCCTGG - Intronic
1121050462 14:90816381-90816403 CGGGCTCGGGCTCCGGCTCCCGG + Exonic
1121438689 14:93935249-93935271 CAGTCTCTGCCCCCTTATCCTGG - Intronic
1121833069 14:97068765-97068787 CTGGCTCTGCCCCTTTCTGCCGG + Intergenic
1122980690 14:105191225-105191247 CCAGCTCTGGCCCCTTCCCCGGG + Intergenic
1123056246 14:105572043-105572065 CCGCCTGGGGCCCCTTCTCCAGG - Intergenic
1123057687 14:105579764-105579786 CCGCCTGGGGCCCCTTCTCCAGG + Intergenic
1123080675 14:105692171-105692193 CCGCCTGGGGCCCCTTCTCCAGG - Intergenic
1123081966 14:105699697-105699719 CCGCCTGGGGCCCCTTCTCCAGG + Intergenic
1123920097 15:25064079-25064101 CTGTCTCTGGCCCCTTTACCAGG - Intergenic
1126054872 15:44720629-44720651 CGGGATCTGACACCATCTCCAGG - Intergenic
1126099832 15:45112482-45112504 CGGGATCTGGCCCCTCCCCCAGG + Intronic
1126106100 15:45148016-45148038 CCTGCCCTGGCCCATTCTCCTGG - Intronic
1128876158 15:71203052-71203074 CAGGCTCTCTCCCATTCTCCAGG - Intronic
1128999398 15:72319955-72319977 CGGGCTCCGCCCCCTCCCCCTGG - Exonic
1129109801 15:73330700-73330722 CGGGCTCCTGCGCCTTCCCCTGG - Intronic
1130991552 15:88878872-88878894 GGAGCTCTGGCCCCCTCTGCTGG - Intronic
1131055295 15:89371318-89371340 CGCGCTCTGGTCCCATTTCCCGG - Intergenic
1132537074 16:487569-487591 CTGACTCTGCCCCCTTCTCCTGG + Intronic
1132591104 16:726878-726900 CCGGCGCTGGCACCTCCTCCAGG - Intronic
1132625408 16:889224-889246 AGGGGGCTGGCCCCTTCTCTTGG + Intronic
1132648002 16:1007903-1007925 CGGCCCCTGGCCCCGTTTCCTGG + Intergenic
1132769393 16:1552449-1552471 CGGGGTCTGGCACTTTCTGCCGG - Intronic
1133173918 16:3999451-3999473 ATGGCTCTGGCCCCCTTTCCTGG + Intronic
1134085815 16:11356855-11356877 CGGGCGCTGGCCCCCCCTGCTGG + Intergenic
1135721741 16:24823508-24823530 CAGTCTCTGACCCCTTCTCCCGG + Exonic
1136317196 16:29461360-29461382 CTGGCTCTGGCCCCTGATGCAGG + Exonic
1136431771 16:30200703-30200725 CTGGCTCTGGCCCCTGATGCAGG + Exonic
1137502093 16:49019500-49019522 CTGGCTCTGCTCCCTTCCCCAGG + Intergenic
1137577059 16:49606966-49606988 CTGGCTCTGTCTCCTGCTCCTGG - Intronic
1138433328 16:56983304-56983326 GGGGCTCTGTCCCCTGCCCCAGG + Exonic
1138512442 16:57516394-57516416 CCAGCTCTGCCACCTTCTCCTGG + Exonic
1139700677 16:68706308-68706330 AGGGCACTGGCCGCTGCTCCTGG - Intronic
1140512399 16:75517495-75517517 CGGGCAGGGGCCGCTTCTCCAGG - Intergenic
1140732074 16:77865440-77865462 CTGGCTCTGGCACAGTCTCCAGG - Intronic
1140954247 16:79847477-79847499 CCTTCTCTGGACCCTTCTCCCGG + Intergenic
1141361248 16:83397053-83397075 CTCGCTCTGGCCCTTTCTCCTGG + Intronic
1141434763 16:83993757-83993779 CTGGGCCTGGCCCCATCTCCCGG - Intronic
1141451822 16:84108733-84108755 CAGGCTCTGACCCCCTCACCTGG - Intronic
1141554375 16:84827234-84827256 CGGAGTCTGGCCCCTTCTGTTGG + Intronic
1141627322 16:85268175-85268197 CGAGCTGTGGCCCCTTCCCTGGG - Intergenic
1141677951 16:85527461-85527483 CTGGCTCTGGCCCCAGCTCTGGG - Intergenic
1142314674 16:89336147-89336169 AGGCCTCTGGCCACTTGTCCAGG + Intronic
1142431074 16:90027733-90027755 CGGGCTGTGGCCCAGTCCCCGGG + Intronic
1142599051 17:1044173-1044195 CCGGCTCTTGCCCCTGCCCCCGG - Intronic
1142642954 17:1295310-1295332 GAGGCCCTGGCCACTTCTCCGGG + Intronic
1142719341 17:1766098-1766120 TGGGTTCTGCCCCATTCTCCTGG + Intronic
1143289879 17:5820532-5820554 AGGACCCTGGCCCCTTCTCAGGG + Intronic
1143874636 17:9982233-9982255 GGGGCTCTGGACTCTTCTCCTGG + Intronic
1144950072 17:18989222-18989244 AGGTCCCTGGCCTCTTCTCCAGG - Intronic
1146255261 17:31388645-31388667 GGGACTCCGGCCCCTTCTCTAGG - Intergenic
1148126531 17:45240365-45240387 AGGGCTCAGGCCCCTTCCTCTGG + Intronic
1151784209 17:76267115-76267137 CGGGTGCTGGCCATTTCTCCTGG - Intronic
1151886093 17:76924147-76924169 GGGGCTTTGAACCCTTCTCCAGG + Intronic
1152250919 17:79212181-79212203 GGGTCTCTGGACTCTTCTCCAGG + Intronic
1152580820 17:81164971-81164993 CGTGCACTGGGCCCTGCTCCAGG + Intronic
1152633394 17:81420658-81420680 CGGGCTCTGGCCCCAGCTCCAGG - Intronic
1152751397 17:82064076-82064098 CTGGCTCTGGCCCCTGCCCCAGG + Intronic
1153947897 18:10032856-10032878 CCGGCCTTGGCCGCTTCTCCCGG - Intergenic
1155877060 18:31101485-31101507 TGGCCTCTGGCACCTTCCCCGGG - Intronic
1157485793 18:48085896-48085918 GGGGCTCTGGTTCCTTCTCCAGG + Intronic
1157695124 18:49716431-49716453 CTGGCTTTAGCCCCTTTTCCAGG + Intergenic
1157752966 18:50194808-50194830 GGGGCTCGGGCCCCGGCTCCTGG + Exonic
1158435215 18:57430600-57430622 AGGGCTTTGGCACCTGCTCCAGG - Intergenic
1159521627 18:69532235-69532257 AGAGCTCTGGTCCCTTCTCCCGG + Intronic
1159773279 18:72574448-72574470 CGGCCACAGCCCCCTTCTCCTGG - Intronic
1160222074 18:76984977-76984999 CGGGGCCTGGGCCCTTCCCCGGG - Intronic
1160304464 18:77718640-77718662 TGGGTCCTGGCCCCTCCTCCTGG + Intergenic
1160619689 18:80162060-80162082 CAGGCTCTGGCACATGCTCCAGG + Intronic
1160701098 19:507806-507828 CGCGCTATGGCACCTTCGCCTGG + Exonic
1160874125 19:1289493-1289515 CGGGCCCTGGTCCCGTCCCCAGG - Intronic
1161044908 19:2129576-2129598 CTGGCTCTGCCACCTCCTCCTGG + Intronic
1161087361 19:2341233-2341255 GGGGCTCCGGCCTCTCCTCCCGG - Intronic
1161217992 19:3104343-3104365 CGGACTCTGGCCCCTCCTAGTGG + Intronic
1161219297 19:3110685-3110707 CTGGTTCCGGCCCCTTCCCCAGG + Intronic
1161277868 19:3428872-3428894 ACGGCTCTGGCCACTTCTCCTGG + Intronic
1162794342 19:13078801-13078823 TCAGCTCTGGCCCCTTCACCTGG - Intronic
1162998762 19:14352766-14352788 GGCCCTCTGGCCCCTGCTCCTGG - Intergenic
1163033434 19:14558835-14558857 CAGGCTCTGGCCCCATCTCCAGG - Intronic
1163298089 19:16425271-16425293 AGGGCACGGGCTCCTTCTCCAGG + Exonic
1163311100 19:16514996-16515018 CCGCCTCTGGCCCCATCTCGGGG - Intronic
1164678976 19:30121470-30121492 CTGGGTCTTACCCCTTCTCCAGG - Intergenic
1164750167 19:30647890-30647912 AGGGACCTGGCCCCATCTCCGGG + Intronic
1165021149 19:32925512-32925534 CGGAGTCTGGCCCCATCGCCAGG + Intronic
1165360247 19:35332052-35332074 CGGCCCCTGGCTCCTGCTCCTGG + Exonic
1165795803 19:38518493-38518515 CAGCCTCTGGCCCCTTACCCTGG - Intronic
1166546817 19:43639219-43639241 TGGTCTCTGTCCCCTTTTCCTGG - Intronic
1166699704 19:44875032-44875054 GGGTCTCTGGCCCTATCTCCAGG - Intronic
1166861884 19:45815943-45815965 CGCACTCAGGCCCCTCCTCCCGG + Exonic
1167135006 19:47610469-47610491 CGGCCTCTGACCCCACCTCCCGG - Intronic
1167281546 19:48572160-48572182 GAGGCTGTGGCCCCATCTCCTGG + Intronic
1167368309 19:49065931-49065953 GGGGCTCTGTCCCCTTCTCGGGG - Intergenic
1167492892 19:49802153-49802175 TGGGCCCGGGCCCCTTCTCGCGG + Intronic
1168078258 19:53992036-53992058 CGGCCACCGGCCCCTTTTCCAGG + Intergenic
925155028 2:1642491-1642513 CGGGATCTGGCCCCACCTCCCGG + Intronic
925308704 2:2866775-2866797 AGGGCCATGGCCCCTTCTCCAGG - Intergenic
926044855 2:9703124-9703146 GGGGCCCTGGCCCCACCTCCGGG - Intergenic
926167520 2:10530776-10530798 CAGGCTCTGGTCCCAGCTCCAGG + Intergenic
927177926 2:20423227-20423249 CAAGCTCTTGCCCCTGCTCCAGG + Intergenic
927214290 2:20658237-20658259 GGGGCTCTTCCCCCTTCTCTTGG - Intergenic
927809332 2:26173018-26173040 CGGGCCCCGCCCCCTCCTCCCGG - Intergenic
927862915 2:26571252-26571274 CTGGGTCTGGCTCCTTCCCCAGG - Intronic
927869707 2:26615725-26615747 CGGGCTCTGGCCCCCTGCCTCGG - Intronic
930485561 2:52007130-52007152 CGAGCACTGTCCCCTGCTCCAGG + Intergenic
932451610 2:71814150-71814172 CCAGCTCTAGCCCCATCTCCTGG + Intergenic
933787367 2:85854260-85854282 GTGGCTTTGGCTCCTTCTCCAGG + Intronic
934882453 2:97995744-97995766 CGGGCTCTGGCCGCGGCGCCGGG + Exonic
936840123 2:116758507-116758529 CTGACACTGGCCCCTTCTGCTGG + Intergenic
937060864 2:118979544-118979566 CTGGCTGAGGCCCCTTCTCTGGG - Intronic
937427330 2:121811230-121811252 CAGGCTCTGGCCCTGCCTCCTGG + Intergenic
937775117 2:125767091-125767113 CAGGCTCTGCACCCCTCTCCAGG - Intergenic
937982869 2:127625264-127625286 CGGGCTCTTGCCCCATCACAGGG - Intronic
939900492 2:147844547-147844569 CAGGCTCTGGCTCCAGCTCCGGG - Exonic
941040318 2:160614284-160614306 CAGCCTCTGCCCCATTCTCCAGG - Intergenic
946370574 2:219279282-219279304 CCGGCTCCGCCCTCTTCTCCCGG + Exonic
946412358 2:219521684-219521706 CGGCCTCTGTCCCCTCCTGCAGG - Intronic
947127107 2:226881109-226881131 GGGGCTCTTCCCCCTTCTCTTGG - Intronic
947796609 2:232897141-232897163 GGGGGTCTGGCCCCTTCCCCAGG + Intronic
947816283 2:233039821-233039843 CAGGCTGTGGCACCTTGTCCGGG + Intergenic
948465480 2:238149842-238149864 TGGGCACTGTCCCCTTCACCAGG - Intronic
948495386 2:238345467-238345489 CTGGCTCTGGCCCTTCCTCTGGG - Intronic
948801778 2:240436380-240436402 CGGGCTCGGGGCGCTCCTCCCGG + Intronic
1170907790 20:20531355-20531377 CGTGCTCTGGCCTCTTCAGCAGG - Intronic
1170989209 20:21286833-21286855 CTGACCCTTGCCCCTTCTCCTGG + Intergenic
1172097639 20:32468068-32468090 GGGGCTGTGGCCCCTCATCCTGG - Intronic
1172969787 20:38865033-38865055 TGGGCTCTGTCCCCTTAGCCAGG + Intronic
1173310641 20:41893517-41893539 TGGGCTCTGGCCTCTTCTCTGGG + Intergenic
1173827910 20:46058899-46058921 CGGCCTCTAGCTCCGTCTCCCGG + Intronic
1173937624 20:46880986-46881008 GGGGTTCTGGCACCTTGTCCAGG - Intergenic
1174102959 20:48141105-48141127 CTGACTCTGGCCCCTTCACTTGG + Intergenic
1175662892 20:60832271-60832293 CTTGCTAAGGCCCCTTCTCCTGG + Intergenic
1176131794 20:63499387-63499409 CCGGCTCTCGCCCCGTCTCCCGG - Intergenic
1179502416 21:41818498-41818520 CAGGCTCTTGCCCCTCCTCCAGG - Intronic
1179723320 21:43328319-43328341 CAGGCCCAGCCCCCTTCTCCAGG - Intergenic
1179997632 21:44981281-44981303 GGACCTCTGGCCCCTTCTCAGGG + Intergenic
1180050625 21:45329497-45329519 CGTTCTCCGGCCCCTCCTCCAGG + Intergenic
1181063230 22:20291934-20291956 AGGGCTCGGGCCCCTTCAGCTGG + Intergenic
1181313865 22:21959831-21959853 CCCGCTCTGGCCCGTCCTCCTGG + Intronic
1181463594 22:23099127-23099149 GGGGCTGTGGCTCCTTCGCCAGG - Intronic
1181814698 22:25429475-25429497 CAGGCCCTGCCCCCTTCTCAGGG + Intergenic
1181950530 22:26550600-26550622 TGGGCACTGGGCCCTGCTCCAGG - Intronic
1182355002 22:29718969-29718991 CTGGCTGTGGCCCCATCTCTGGG - Intergenic
1182410922 22:30185254-30185276 AGTTCTCTGGCCCCTCCTCCAGG + Intergenic
1182420708 22:30247247-30247269 CCGGCCCCGGCCCCTCCTCCTGG - Intergenic
1183407095 22:37635577-37635599 CAGGCCCTTGCCACTTCTCCTGG - Intronic
1183425114 22:37735041-37735063 CGGGCCCAGACCCCCTCTCCTGG - Exonic
1183432618 22:37774817-37774839 TGGGCCCTGGGCCCTACTCCAGG - Exonic
1183571560 22:38656857-38656879 CGGCCTCCGTCCCCTTCCCCAGG - Intronic
1184235250 22:43179797-43179819 TGGGCTGAGGCCCCTCCTCCAGG + Intronic
1184564674 22:45284988-45285010 CGCGCTCTGGCGGCTCCTCCCGG + Exonic
1185023309 22:48393185-48393207 CGGACACTCGGCCCTTCTCCGGG - Intergenic
1185221358 22:49630586-49630608 CTCGTTCTGGGCCCTTCTCCCGG - Intronic
950189407 3:10966318-10966340 TGGGCTCAGTTCCCTTCTCCAGG + Intergenic
950442127 3:13016218-13016240 CGGGCCCAGGCCCCTCCTCCAGG + Intronic
950534605 3:13571714-13571736 TGGGCTCTGGCCGCTGCCCCAGG + Intronic
952193395 3:31047250-31047272 CTGGCAATGGCCCCTTCTGCTGG + Intergenic
953315846 3:41925566-41925588 CTGGCTTTGGCCCCCTTTCCAGG - Intronic
953344702 3:42165615-42165637 AGGACTCAGGCCCCTTCTCTGGG - Intronic
954286400 3:49622600-49622622 TGGGCTGTGGCCCCCTCTCCAGG - Intronic
954417028 3:50398245-50398267 TGGGCTCTGGGCTCTGCTCCTGG + Intronic
960153665 3:114276050-114276072 CTTGCTCTGCCCCCTCCTCCTGG + Intergenic
960747696 3:120908254-120908276 CGGGCTCCGGCCGCTTCTCTGGG - Exonic
961905558 3:130259589-130259611 CAGGCTCTGGGCCCTCCTCCAGG - Intergenic
963607158 3:147421278-147421300 CGGGCTCTGGCGCCGACCCCAGG - Intronic
966225792 3:177596653-177596675 TGGGGTCTGGCACCTTTTCCTGG - Intergenic
968286169 3:197510110-197510132 CGGGCTCTTCTGCCTTCTCCTGG + Exonic
968514406 4:1010253-1010275 CGGTCCCTGGACCCTTCCCCGGG + Intronic
968593388 4:1470874-1470896 CAGGCTCTGTCTCCTCCTCCAGG + Intergenic
968750617 4:2387087-2387109 CTGGCTCAGCCCCCTCCTCCAGG - Intronic
968789829 4:2651880-2651902 CGGGGTCTGGACTCTCCTCCTGG - Intronic
968941717 4:3642556-3642578 CGTGCTCTGTGCTCTTCTCCAGG + Intergenic
969315377 4:6378584-6378606 GGTGCTCAGGCCCCTTCTCCGGG - Intronic
969503940 4:7571714-7571736 CTGGCCTTGGCCCCTTTTCCTGG - Intronic
969693906 4:8724373-8724395 CTGCCTCTGTCCCTTTCTCCAGG - Intergenic
970419856 4:15895700-15895722 CAGGCTCTGGCCCCGGCACCGGG - Intergenic
971363214 4:25955448-25955470 CTGCCTCTGGCCCCTTCCCTAGG + Intergenic
973209838 4:47603442-47603464 CAGGCTCTAGCCACTGCTCCGGG + Exonic
974009264 4:56592593-56592615 CGCGCTCTCGGCCCCTCTCCTGG - Intronic
975415479 4:74099424-74099446 CGGGCTCTCGCTCCCGCTCCAGG - Intergenic
975541322 4:75514703-75514725 CGAGCTCCGCCCCTTTCTCCAGG - Intronic
976160536 4:82193802-82193824 CTGGCTCTTTCCCCTTCTCCTGG + Intergenic
976438271 4:85043808-85043830 CTGGCTCCAGCCCCTTTTCCAGG - Intergenic
978917933 4:114148618-114148640 CGAGCACTGCCCCCTGCTCCAGG - Intergenic
979078750 4:116307670-116307692 CAGGCTCTGCCTCCTTTTCCTGG - Intergenic
983179429 4:164630604-164630626 CTGGCTTTAGCCCCTTTTCCAGG - Intergenic
984711821 4:182892157-182892179 CGTGCCCTGGCCCCTTGTGCTGG - Intronic
985624342 5:977272-977294 TGGGCACTGGTCCCTTGTCCAGG + Intergenic
985781826 5:1875649-1875671 TGGGCTCTGGGTCCCTCTCCTGG - Intergenic
989998758 5:50867451-50867473 TGGGCTCTGGTCCCTCCACCAGG + Intergenic
990987749 5:61656404-61656426 AGTGCTCTGGCCCCTTCTAAAGG + Intronic
991599920 5:68341966-68341988 CTGGCCCTTACCCCTTCTCCTGG - Intergenic
995712434 5:115049252-115049274 CTGCCTCTGCCCCATTCTCCTGG + Intergenic
996011592 5:118486714-118486736 GGAACACTGGCCCCTTCTCCGGG - Intergenic
996404109 5:123089905-123089927 CCGGCTCGGGCACTTTCTCCAGG + Intronic
997368837 5:133343121-133343143 AGGGCTCAGGCCACTTGTCCTGG + Intronic
997437207 5:133884143-133884165 AGGGCCTCGGCCCCTTCTCCTGG - Intergenic
998232831 5:140372343-140372365 CTGGCTCCAGCCCCTTCTCAGGG - Exonic
999270619 5:150294566-150294588 CTGGCTCTGGCCCCTACAGCTGG + Intergenic
1002027432 5:176404921-176404943 CAGGCTCTGGCGCCTGATCCTGG + Intronic
1002057012 5:176603947-176603969 AGGGCACTGGCCCCTTCTAAAGG + Intronic
1003164407 6:3663719-3663741 CTGCCTCTGGCACCCTCTCCAGG + Intergenic
1006626632 6:35402496-35402518 CTGTCTCTGGTCTCTTCTCCAGG + Intronic
1007418042 6:41703429-41703451 CTGGCTCCTGCCCCTGCTCCTGG + Intronic
1007496399 6:42262906-42262928 CAGGCCCTGGCCCCTTCCCCAGG - Intronic
1007701921 6:43770793-43770815 CGGGCTCCGGCCCCTGCCCGCGG - Exonic
1008567874 6:52786807-52786829 CGAGCGCTGCCCCCTGCTCCAGG + Intergenic
1009275999 6:61681036-61681058 CGGGTTGTGGCCCATTCTTCTGG + Exonic
1009702291 6:67200656-67200678 GGGGCACTTGCCCCTTCTCTGGG - Intergenic
1010453685 6:76030676-76030698 CGGACAATGGCCCCTTCTGCTGG + Intronic
1015376090 6:132512659-132512681 CCGGCTCTGGCGCCCTCCCCGGG + Intronic
1015656442 6:135524516-135524538 CACGATCTGACCCCTTCTCCAGG - Intergenic
1017517628 6:155171451-155171473 TGGGCCTTGGCCCCTTCTTCTGG + Intronic
1017693942 6:156995129-156995151 GGGGCTGTGCCCTCTTCTCCCGG + Intronic
1018419759 6:163631094-163631116 GGGGCTCTGGTCCCTTCCCTGGG + Intergenic
1019289077 7:241174-241196 CTGGGTCTGGCCCCTTCCCTGGG + Intronic
1020013355 7:4818015-4818037 AGGGTCCTGGCCCCTTCCCCAGG - Intronic
1020034956 7:4959145-4959167 CGGGCTCCGGCTCCGGCTCCGGG - Exonic
1020035073 7:4959458-4959480 CTGGCCCCGGCCCCTTTTCCCGG + Intergenic
1020131919 7:5563494-5563516 CGCTCTCTGGCCCCTGCACCTGG + Intronic
1022524510 7:31028577-31028599 CGGGCTCTGTCCCCAGCTCCTGG + Intergenic
1022869091 7:34457379-34457401 CTGGCTTTAGCCCCTTTTCCAGG - Intergenic
1024064224 7:45719158-45719180 GGGGCTCTGCCCCCTGCTGCTGG - Exonic
1025998404 7:66542964-66542986 CCAGCTCAGGCCCCGTCTCCAGG + Intergenic
1026991365 7:74587765-74587787 CCAGCTCAGGCCCCATCTCCAGG + Intronic
1029705610 7:102274261-102274283 TGGGCTCTGGGATCTTCTCCAGG - Intronic
1031146440 7:118002290-118002312 AAGGATCTTGCCCCTTCTCCGGG + Intergenic
1031553438 7:123143035-123143057 AGGGCACTGGCCCCCTTTCCAGG - Intronic
1032075140 7:128832534-128832556 GGGGCTCTCGGCCCCTCTCCAGG + Intronic
1033439124 7:141362827-141362849 CGGGCTGTAGCCATTTCTCCTGG + Intronic
1034265221 7:149777451-149777473 TGTGCTCTGGGCCCTTCTACAGG + Intergenic
1034455293 7:151167059-151167081 GGGGCTCTGCCACTTTCTCCCGG + Exonic
1034726944 7:153344918-153344940 CTGGATTTGGCCACTTCTCCAGG + Intergenic
1036281018 8:7401608-7401630 CCAACTCTGGCTCCTTCTCCTGG + Intergenic
1036340447 8:7909964-7909986 CCAACTCTGGCTCCTTCTCCTGG - Intergenic
1036698413 8:10994320-10994342 CTGGCTCTAGGCCCCTCTCCTGG + Intronic
1037754091 8:21700339-21700361 CAGGCTTTGGCCCCCTCTCTGGG - Intronic
1038035430 8:23682709-23682731 CTGGCTCTGGCTCCGGCTCCGGG + Exonic
1038406408 8:27325797-27325819 CTGGGTCTGGCCGTTTCTCCGGG - Intronic
1039898876 8:41736183-41736205 AGTGCTCTCTCCCCTTCTCCTGG - Intronic
1040065089 8:43139128-43139150 CGGACCATGGCCCCTTCTGCTGG + Intergenic
1043502836 8:80873912-80873934 CGGGCTCCCGCCCCCTGTCCCGG - Intronic
1044067532 8:87717330-87717352 GGGGCTCTTCCCCCTTCACCTGG + Intergenic
1044503033 8:92983769-92983791 TGGACTCTCGCCCCTTATCCTGG - Intronic
1045908614 8:107378709-107378731 CGGGCTCTTCCCCCTTCCCTTGG + Intronic
1047641313 8:126824574-126824596 AGGGCTCTGGCGCCCTCTGCTGG - Intergenic
1048176136 8:132154392-132154414 TGGGCAATGGCCCCTTCTCGTGG + Intronic
1048748313 8:137641457-137641479 AGGGCTCTTCCCCCTTTTCCTGG + Intergenic
1049544211 8:143221894-143221916 TGGGCTCTGCACCCTACTCCAGG + Intergenic
1049690551 8:143957076-143957098 CCGGCTGTAGCCCCGTCTCCAGG - Intronic
1049747032 8:144267319-144267341 CGGGGGCTGGGGCCTTCTCCTGG + Intronic
1049749991 8:144278496-144278518 CGGGCTCTGCCCTCACCTCCTGG + Intronic
1050537819 9:6645542-6645564 CGCGCTCTTGGCCCCTCTCCTGG + Exonic
1051940243 9:22496427-22496449 CTGGCTTTGGCCCCCTTTCCAGG + Intergenic
1054755635 9:68954832-68954854 CTGGCTCTTGCCCCATCTGCTGG + Intronic
1054880065 9:70135377-70135399 AGGCCTCTGGCCCCATCTTCAGG + Intronic
1056655363 9:88504278-88504300 CAGGCCCTGGGCCCTGCTCCTGG + Intergenic
1057225289 9:93289652-93289674 CGGGCTCCGGCCCCTGACCCAGG - Intronic
1057314810 9:93961320-93961342 TGGGCCCTGGCCCCTTAGCCAGG + Intergenic
1057337188 9:94165627-94165649 CGGTCTCTCGCTCTTTCTCCAGG - Intergenic
1057701557 9:97366497-97366519 GGGACTCTGGCCCTTGCTCCTGG - Intronic
1059160301 9:112028345-112028367 AGGGCACTGGCCCTTACTCCTGG - Intergenic
1059467453 9:114477986-114478008 CAGGGTCTTGCCCCTTCTCGTGG - Intronic
1059634716 9:116159632-116159654 CGGCCTCTTGCTCCTTCCCCAGG + Intronic
1060525059 9:124315771-124315793 GGGGATTTGGTCCCTTCTCCAGG + Intronic
1061036593 9:128117813-128117835 CGGGCTCTGGCGCCCTCTGGTGG + Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061820926 9:133226825-133226847 CTGGCACTGGCCACTTATCCTGG + Intergenic
1062268852 9:135699724-135699746 TGGGCTGGGGCCCCTTCCCCTGG - Intergenic
1062337528 9:136078845-136078867 GGGCCTCTCGCCCCTTGTCCAGG + Intronic
1062362318 9:136193776-136193798 CGGCCTCCGGCCCCTCCCCCAGG - Intergenic
1062569770 9:137179700-137179722 CCAGCCCTGCCCCCTTCTCCAGG - Intronic
1062618095 9:137407151-137407173 CGGTCTCTGGGCCCCTCTGCTGG + Intronic
1062630966 9:137462880-137462902 CAGGCTCTGCCCCCGTCCCCTGG - Intronic
1062678663 9:137763911-137763933 AGGGCTCTGCCCGCTCCTCCCGG - Intronic
1191183006 X:57582197-57582219 TGGGCTCTTACCTCTTCTCCAGG + Intergenic
1191214362 X:57920178-57920200 TGGGCTCTTACCTCTTCTCCAGG - Intergenic
1197769749 X:130082502-130082524 CTGGCTCAGGCCCCTTTTCCAGG + Intronic
1197776565 X:130122041-130122063 AGGTCACTGGCCCTTTCTCCTGG + Intergenic
1199592885 X:149484340-149484362 CGGGGTCTAGCCCTGTCTCCAGG + Intronic
1200120084 X:153786084-153786106 CTGGATCTGGCCCCATCTTCTGG - Intronic
1200134121 X:153866679-153866701 GGGGCTCTGGTCCCTTGCCCTGG + Exonic
1200216060 X:154368746-154368768 TGGGCTCTGGGCCCCTCCCCTGG - Intronic