ID: 923035973

View in Genome Browser
Species Human (GRCh38)
Location 1:230285399-230285421
Sequence GGCTCTGGGCAGTGCGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035973_923035987 30 Left 923035973 1:230285399-230285421 CCCGGGTCGCACTGCCCAGAGCC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035973_923035982 -4 Left 923035973 1:230285399-230285421 CCCGGGTCGCACTGCCCAGAGCC No data
Right 923035982 1:230285418-230285440 AGCCGGGTCCTTGGGAAGCCGGG No data
923035973_923035981 -5 Left 923035973 1:230285399-230285421 CCCGGGTCGCACTGCCCAGAGCC No data
Right 923035981 1:230285417-230285439 GAGCCGGGTCCTTGGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035973 Original CRISPR GGCTCTGGGCAGTGCGACCC GGG (reversed) Intergenic
No off target data available for this crispr