ID: 923035979

View in Genome Browser
Species Human (GRCh38)
Location 1:230285413-230285435
Sequence CTTCCCAAGGACCCGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035979_923035992 23 Left 923035979 1:230285413-230285435 CCCAGAGCCGGGTCCTTGGGAAG No data
Right 923035992 1:230285459-230285481 TCCTCCCATGTCATGGAAGTGGG No data
923035979_923035991 22 Left 923035979 1:230285413-230285435 CCCAGAGCCGGGTCCTTGGGAAG No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035979_923035987 16 Left 923035979 1:230285413-230285435 CCCAGAGCCGGGTCCTTGGGAAG No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035979 Original CRISPR CTTCCCAAGGACCCGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr