ID: 923035980

View in Genome Browser
Species Human (GRCh38)
Location 1:230285414-230285436
Sequence GCTTCCCAAGGACCCGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035980_923035991 21 Left 923035980 1:230285414-230285436 CCAGAGCCGGGTCCTTGGGAAGC No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035980_923035992 22 Left 923035980 1:230285414-230285436 CCAGAGCCGGGTCCTTGGGAAGC No data
Right 923035992 1:230285459-230285481 TCCTCCCATGTCATGGAAGTGGG No data
923035980_923035987 15 Left 923035980 1:230285414-230285436 CCAGAGCCGGGTCCTTGGGAAGC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035980 Original CRISPR GCTTCCCAAGGACCCGGCTC TGG (reversed) Intergenic
No off target data available for this crispr