ID: 923035983

View in Genome Browser
Species Human (GRCh38)
Location 1:230285420-230285442
Sequence TTCCCGGCTTCCCAAGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035983_923035991 15 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035983_923035987 9 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data
923035983_923035996 25 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035983_923035992 16 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035992 1:230285459-230285481 TCCTCCCATGTCATGGAAGTGGG No data
923035983_923035997 30 Left 923035983 1:230285420-230285442 CCGGGTCCTTGGGAAGCCGGGAA No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035983 Original CRISPR TTCCCGGCTTCCCAAGGACC CGG (reversed) Intergenic
No off target data available for this crispr