ID: 923035984

View in Genome Browser
Species Human (GRCh38)
Location 1:230285426-230285448
Sequence GACTGCTTCCCGGCTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
923035984_923035996 19 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035996 1:230285468-230285490 GTCATGGAAGTGGGTTTTGCTGG No data
923035984_923035992 10 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035992 1:230285459-230285481 TCCTCCCATGTCATGGAAGTGGG No data
923035984_923035998 27 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035998 1:230285476-230285498 AGTGGGTTTTGCTGGCAAGGAGG No data
923035984_923035997 24 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035997 1:230285473-230285495 GGAAGTGGGTTTTGCTGGCAAGG No data
923035984_923035991 9 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG No data
923035984_923035987 3 Left 923035984 1:230285426-230285448 CCTTGGGAAGCCGGGAAGCAGTC No data
Right 923035987 1:230285452-230285474 TCCCACCTCCTCCCATGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
923035984 Original CRISPR GACTGCTTCCCGGCTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr